Rapid screening and cultivation of Ehrlichia canis from refrigerated carrier blood

McClure, Jennifer C.; Crothers, Michelle L.; Schaefer, John J.; Stanley, Patrick D.; Stich, Roger W.

doi:10.1111/j.1469-0691.2008.02192.x

Cited by 4 publications

(5 citation statements)

References 4 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Samples were incubated at 94°C for 2 min, followed by 75 cycles at 94, 65, and 72°C for 30 s each, with a final extension for 7 min at 72°C. Positive controls consisted of 10 pg of DNA extracted from E. canis-infected DH82 cell cultures that were prepared as previously described (6,35) while negative controls consisted of preinoculation canine blood and unexposed ticks. No-template controls served as tests for contamination for every assay.…”

Section: Methodsmentioning

confidence: 99%

“…A p30-based PCR assay was used to test for the presence of E. canis DNA as previously described elsewhere, with some modifications (6,35,42,43,47). Briefly, 25-l reaction mixtures were prepared with 2% dimethyl sulfoxide (DMSO), 2.0 mM MgCl 2 , 200 M of each deoxynucleoside triphosphate (dNTP), 0.3 M (each) of primers ECA30-384S (ATAAACACGCTGACTTT ACTGTTCC) and ECA30-583A (GTGATGAGATAGAGCGCAGTACC), and 0.03 U/l of Platinum Taq polymerase (Invitrogen, Carlsbad, CA).…”

Section: Methodsmentioning

confidence: 99%

“…Heparinized blood samples (1 ml) were centrifuged at 1,200 ϫ g for 30 min, buffy coat layers were isolated (ϳ200 l), and DNA was extracted with a High Pure Viral Nucleic Acid Isolation kit (Roche, Indianapolis, IN) as previously described elsewhere (35). Two extra buffy coats were stored at Ϫ80°C for each sample collected as replicates in the event that PCR-positive samples were observed after doxycycline treatment; samples were interpreted as negative when frozen replicates tested negative by PCR.…”

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

Efficacy of a Doxycycline Treatment Regimen Initiated during Three Different Phases of Experimental Ehrlichiosis

McClure

Crothers

Schaefer

et al. 2010

Antimicrob Agents Chemother

View full text Add to dashboard Cite

Doxycycline is the treatment of choice for canine monocytic ehrlichiosis (CME), a well-characterized disease and valuable model for tick-borne zoonoses. Conflicting reports of clearance of Ehrlichia canis after treatment with doxycycline suggested that the disease phase during which treatment is initiated influences outcomes of these treatments. The purpose of this study was to evaluate the efficacy of a 28-day doxycycline regimen for clearance of experimental E. canis infections from dogs treated during three phases of the disease. Ten dogs were inoculated with blood from E. canis carriers and treated with doxycycline during acute, subclinical, or chronic phases of CME. Daily rectal temperatures and semiweekly blood samples were monitored from each dog, and Rhipicephalus sanguineus ticks were acquisition fed on each dog for xenodiagnosis. Blood collected from dogs treated during acute or subclinical CME became PCR negative for E. canis as clinical parameters improved, but blood samples collected from dogs treated during chronic CME remained intermittently PCR positive. R. sanguineus ticks fed on dogs after doxycycline treatments became PCR positive for E. canis, regardless of when treatment was initiated. However, fewer ticks became PCR positive after feeding on two persistently infected dogs treated with doxycycline followed by rifampin, suggesting that antibiotic therapy can reduce tick acquisition of E. canis.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Efficacy of a Doxycycline Treatment Regimen Initiated during Three Different Phases of Experimental Ehrlichiosis

McClure

Crothers

Schaefer

et al. 2010

Antimicrob Agents Chemother

View full text Add to dashboard Cite

show abstract

“…Although doxycycline can successfully clear E. canis infection when administered for 4 weeks, another study [38] reported persisting abnormalities of the liver and kidney through ultrasonography after treatment. Mcclure et al [39] reported that the treatment of dogs with acute or subclinical CME with doxycycline for 28 days resulted in them becoming PCR negative for E. canis along with improved clinical parameters. Nevertheless, in the chronic CME cases in this study, there were still abnormalities in hematology, serum chemistry profiles, and ultrasonographic changes in the liver, kidney, and spleen after treatment with doxycycline for 28 days.…”

Section: E Canis=ehrlichia Canismentioning

confidence: 99%

Retrospective analysis of canine monocytic ehrlichiosis in Thailand with emphasis on hematological and ultrasonographic changes

et al. 2022

View full text Add to dashboard Cite

Background and Aim: Canine monocytic ehrlichiosis (CME) is a tropical endemic tick-borne disease that causes fatality or chronic infection involving many organs in dogs. This study aimed to examine the prevalence, risk factors, and hematological and ultrasonographic changes in the liver, gallbladder, kidneys, and spleen following CME infection. Materials and Methods: This retrospective study used 30,269 samples collected from dogs at the hematology section of the pathology unit of a university veterinary hospital and 35 samples collected from dogs at the diagnostic imaging unit. CME was determined using the buffy coat smear method. Data were analyzed using descriptive statistics and odds ratios. Results: CCl4 The data revealed that the average yearly prevalence of CME was 1.32%. Risk factors contributing to CME infection were a tick on the body during physical examination, lack of ectoparasite control, and outdoor living. All 148 dogs with CME infection had low platelet counts. The percentages of CME-infected dogs with elevated serum alanine aminotransferase, alkaline phosphatase, and both enzymes above the normal range were 33.6%, 65.9%, and 29.8%, respectively. The rates for elevated serum levels of blood urea nitrogen, creatinine, and both compounds were 33.1%, 19.1%, and 17.3%, respectively. The most common ultrasonographic changes were liver abnormalities (hyperechogenicity or hypoechogenicity, hepatomegaly, and hypoechoic nodules), hyperechogenicity of the kidneys, and an enlarged spleen. These ultrasonographic changes were consistent with the hematology results, which showed a greater elevation of serum liver enzyme levels than renal enzymes. Conclusion: Ultrasonographic changes during CME infection and after treatment with doxycycline can help to monitor and identify persistent pathological changes in the target organs resulting from immune response to CME.

show abstract

“…A dichotomous key was used to identify four adult male and two adult female ticks, which were then bisected along the sagittal plane, pooled and placed on dry ice for template isolation. Nucleic acids were extracted from buffy coat and tick samples with the High Pure Viral Nucleic Acid kit (Roche) as previously described (McClure et al, 2009). Spleen samples were thawed on ice and nucleic acids were isolated from 10 mg portions with the DNeasy Blood & Tissue kit (Qiagen) according to the manufacturer's instructions.…”

Section: Pcr Assays For E Chaffeensismentioning

confidence: 99%

Detection of Ehrlichia chaffeensis in a naturally infected elk (Cervus elaphus) from Missouri, USA

et al. 2015

View full text Add to dashboard Cite

Introduction: Ehrlichia chaffeensis is an emerging zoonotic tick-borne rickettsial pathogen that has been detected in a wide range of vertebrate hosts, including ruminants, canids and primates. Although white-tailed deer (Odocoileus virginianus) are considered the primary reservoir of E. chaffeensis, this pathogen was also reported in other naturally infected cervids, including Korean spotted or sika deer (Cervus nippon) and Brazilian marsh deer (Blastocerus dichotomus).Case presentation: A captive adult bull elk (Cervus elaphus) from east-central Missouri was submitted for post-mortem analysis. The elk was in poor body condition with easily palpable ribs and vertebral spinal processes. Excoriations were noted on the occipital region of the head and on the left scapula, which had moderate amounts of maggots within the lesions. Large numbers of ticks were scattered over the body. Novel and established PCR assays were used to detect E. chaffeensis in blood and spleen samples from this elk, but the pathogen was not detected in Dermacentor albipictus ticks collected at necropsy. Portions of several gene sequences were analysed from the infecting agent.Conclusion To the best of our knowledge this is the first report of E. chaffeensis infection in an elk. It was not determined whether the pathogen contributed to cause of death. Notably, the pathogen was not detected in D. albipictus ticks collected from the elk.

show abstract

Rapid screening and cultivation of Ehrlichia canis from refrigerated carrier blood

Cited by 4 publications

References 4 publications

Efficacy of a Doxycycline Treatment Regimen Initiated during Three Different Phases of Experimental Ehrlichiosis

Efficacy of a Doxycycline Treatment Regimen Initiated during Three Different Phases of Experimental Ehrlichiosis

Retrospective analysis of canine monocytic ehrlichiosis in Thailand with emphasis on hematological and ultrasonographic changes

Detection of Ehrlichia chaffeensis in a naturally infected elk (Cervus elaphus) from Missouri, USA

Contact Info

Product

Resources

About