Rats deficient in the GAD65 isoform exhibit epilepsy and premature lethality

Abstract

GABA is synthesized by glutamate decarboxylase (GAD), which has two isoforms, namely, GAD65 and GAD67, encoded by the Gad2 and Gad1 genes, respectively. GAD65-deficient (Gad2 −/−) mice exhibit a reduction in brain GABA content after 1 month of age and show spontaneous seizures in adulthood. Approximately 25% of Gad2 −/− mice died by 6 months of age. Our Western blot analysis demonstrated that the protein expression ratio of GAD65 to GAD67 in the brain was greater in rats than in mice during postnatal development, suggesting that the contribution of each GAD isoform to GABA functions differs between these two species. To evaluate whether GAD65 deficiency causes different phenotypes between rats and mice, we generated Gad2 −/− rats using TALEN genome editing technology. Western blot and immunohistochemical analyses with new antibodies demonstrated that the GAD65 protein was undetectable in the Gad2 −/− rat brain. Gad2 −/− pups exhibited spontaneous seizures and paroxysmal discharge in EEG at postnatal weeks 3-4. More than 80% of the Gad2 −/− rats died at postnatal days (PNDs) 17-23. GABA content in Gad2 −/− brains was significantly lower than those in Gad2 +/− and Gad2 +/+ brains at PND17-19. These results suggest that the low levels of brain GABA content in Gad2 −/− rats may lead to epilepsy followed by premature death, and that Gad2 −/− rats are more severely affected than Gad2 −/− mice. Considering that the GAD65/GAD67 ratio in human brains is more similar to that in rat brains than in mouse brains, Gad2 −/− rats would be useful for further investigating the roles of GAD65 in vivo. K E Y W O R D S epilepsy, GABA, genome editing, glutamate decarboxylase, rat 2 | KAKIZAKI et Al.

Impact of GAD65 and/or GAD67 deficiency on perinatal development in rats

“…These rats were generated and maintained on a Long–Evans background. The Gad1 KO rats and Gad2 KO rats were deposited at The National BioResource Project for the Rat in Japan (NBRP‐Rat) (https://www.anim.med.kyoto-u.ac.jp/NBR/default.aspx) under strain names LE‐ Gad1 em15Yyan and LE‐ Gad2 em24Yyan , respectively 19,21 …”

“…Genotyping of all mutant rats was performed with PCR using their tail genomic DNA according to Fujihara et al 21 and Kakizaki et al 19 Genotypes of Gad1 KO rats were determined with PCR using the following oligonucleotides: primer P1 (5′‐ACTGGGCCATTGTTCCAGCTCCA‐3′) and primer P2 (5′‐GCTCTCTCACGAGTATGCCCTTGCT‐3′). The primer set of P1 and P2 amplified 512‐bp and 221‐bp fragments specific for the Gad1 WT allele and Gad1 KO allele, respectively.…”

“…GAD65‐deficient ( Gad2 −/− ) mice showed spontaneous seizures in adulthood, and approximately 25% of them died by 6 months of age 10 . In contrast, Gad2 −/− rats exhibited spontaneous seizures during the third postnatal week, and 80% of them died by postnatal day 23 (P23D) 19 . Sixty‐five percent and 60% of Gad1 −/− mice showed cleft palate and omphalocele, respectively, and all of them died at P0D 9,20 …”

Impact of Dysfunctional Feed-Forward Inhibition on Glutamate Decarboxylase Isoforms and γ-Aminobutyric Acid Transporters

“…Such disturbances to phasic, and potentially tonic, inhibition would contribute to CTC disturbances and potentially absence seizure generation or maintenance. GAD65 knockout animals show spontaneous seizures [ 33 , 34 ], but the effect of its upregulation is yet to be determined. Further research tracking GAD65 levels throughout the development of stargazer mice, and genetic or pharmacological manipulation of GAD65 activity, is required to clarify its role in absence seizure genesis.…”

“…GAD65 knockout animals are highly vulnerable to seizures [ 30 , 31 , 32 , 33 ] and have a poor survival rate with 25% of GAD65 knockout mice dying by 6 months of age [ 33 ]. GAD65 knockout rat pups appear normal at birth; however, they begin to exhibit severe (generalised tonic-clonic) or mild (myoclonic) epileptic seizures during the third postnatal week and have an 80% mortality rate within PN23 [ 34 ]. In both studies, the increased lethality of GAD65 knockout animals was attributed to spontaneous seizures.…”