Real-Time PCR Assay with Fluorescent Hybridization Probes for Exact and Rapid Genotyping of the Angiotensin-converting Enzyme Gene Insertion/Deletion Polymorphism

Somogyvári, Ferenc; Szolnoki, Zoltán; Márki-Zay, János; Fodor, Lajos

doi:10.1093/clinchem/47.9.1728

Cited by 15 publications

(8 citation statements)

References 10 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The details of PCR-based protocols used to identify ACE I/D and AGT M235T polymorphisms have been described previously. 33,34 The melting curves were genotyped by two investigators, blind to subjects' metabolic phenotype.…”

Section: Dna Extraction and Genotypingmentioning

confidence: 99%

Insertion/deletion polymorphism of angiotensin-1 converting enzyme is associated with metabolic syndrome in Hungarian adults

Fiatal

Szigethy

Széles

et al. 2011

J Renin Angiotensin Aldosterone Syst

View full text Add to dashboard Cite

The aim of our study was to evaluate whether any association exists between metabolic syndrome (MS) and ACE I/D and AGT M235T gene polymorphisms in Hungarians as an example of European Caucasian population. Study subjects of our cross-sectional study were recruited from the Hungarian General Practitioners' Morbidity Sentinel Stations Program. The study population (n = 1762) approximates very well the age and sex distribution of the general Hungarian population. MS was defined according to the latest diagnostic criteria proposed by the International Diabetes Federation. The frequency of DD genotype (31.36% vs. 25.42%, p = 0.006) and the frequency of D allele (0.56 vs. 0.51, p = 0.006) were significantly higher in the metabolic group than in the non-metabolic group. The distribution of the AGT M235T polymorphism was similar in each group investigated. Association was shown in the case of patients in whom central obesity was combined with elevated TG and low HDL cholesterol level (p = 0.024 and p = 0.022). It suggests that ACE I/D polymorphism is likely to be involved in lipid metabolism.

show abstract

Section: Dna Extraction and Genotypingmentioning

confidence: 99%

Insertion/deletion polymorphism of angiotensin-1 converting enzyme is associated with metabolic syndrome in Hungarian adults

Fiatal

Szigethy

Széles

et al. 2011

J Renin Angiotensin Aldosterone Syst

View full text Add to dashboard Cite

show abstract

“…For the eNOS genotyping, newly created primers were used (7 eNOS F: 5′‐AGGAAACGGTCGCTTCGAC‐3′; 7 eNOS R: 5′‐CAGCAGCATGTTGGACACTG‐3′). The ACE polymorphism was examined by a PCR method developed in order to decrease the examination time and provide a better detection of heterozygotes (13). This method consisted of a fluorescent probe melting point analysis performed with fluorescently labelled oligonucleotide hybridization probes on the LightCycler TM instrument (Roche Diagnostics, Roche Kft, Budapest, Hungary).…”

Section: Dna Analysismentioning

confidence: 99%

Endothelial nitric oxide synthase gene interactions and the risk of ischaemic stroke

et al. 2005

View full text Add to dashboard Cite

show abstract

“…Rigat et al were the first to describe a method for the detection of I/D polymorphisms using polymerase chain reaction (PCR) and agarose gel electrophoresis in 1992 [1,2]. Other techniques including real-time polymerase chain reaction (RT-PCR) [3][4][5], high resolution melting (HRM) [5,6], polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) [7] and microchip electrophoresis (ME) system [8] have also been used to detect I/D polymorphism. However, these techniques require tedious experimental procedures and expensive and sophisticated instruments that may not be available in clinical institutions.…”

Section: Introductionmentioning

confidence: 99%

A Novel PCR Method for Detecting ACE Gene Insertion/Deletion Polymorphisms and its Clinical Application

et al. 2021

View full text Add to dashboard Cite

Background Angiotensin-converting enzyme (ACE) plays a major role in blood pressure regulation and cardiovascular homeostasis. The wide distribution and multifunctional properties of ACE suggest it’s involvement in various pathophysiological conditions. Results In this study, a novel visual detection method for ACE I/D polymorphisms was designed by integrating direct PCR without the need for DNA extraction using gold magnetic nanoparticles (GMNPs)-based lateral flow assay (LFA) biosensor. The entire detection procedure could enable the genotyping of clinical samples in about 80 min. The detection limit was 0.75 ng and results could be obtained in 5 min using the LFA device. Three hundred peripheral blood samples were analyzed using the direct PCR-LFA system and then verified by sequencing to determine accuracy and repeatability. A clinical preliminary study was then performed to analyze a total of 633 clinical samples. Conclusions After grouping based on age, we found a significant difference between the genotypes and the age of patients in the CHD group. The introduction of this method into clinical practice may be helpful for the diagnosis of diseases caused by large fragment gene insertions/deletions.

show abstract

Real-Time PCR Assay with Fluorescent Hybridization Probes for Exact and Rapid Genotyping of the Angiotensin-converting Enzyme Gene Insertion/Deletion Polymorphism

Cited by 15 publications

References 10 publications

Insertion/deletion polymorphism of angiotensin-1 converting enzyme is associated with metabolic syndrome in Hungarian adults

Insertion/deletion polymorphism of angiotensin-1 converting enzyme is associated with metabolic syndrome in Hungarian adults

Endothelial nitric oxide synthase gene interactions and the risk of ischaemic stroke

A Novel PCR Method for Detecting ACE Gene Insertion/Deletion Polymorphisms and its Clinical Application

Contact Info

Product

Resources

About