Recognition of a peroxisomal tripeptide entry signal by the glycosomes of Trypanosoma brucei

Fung, Kelly; Clayton, Christine

doi:10.1016/0166-6851(91)90093-l

Cited by 57 publications

(35 citation statements)

References 17 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Hypotheses on how proteins are targeted to the glycosome have been presented in the past (Wierenga et al, 1987;Swinkels et al, 1988). However, except for the transient expression of a CAT-SKL fusion protein (Fung and Clayton, 1991), none of them have been tested in a functional in vivo assay. Our results show unambiguously that when the cDNA encoding firefly luciferase is expressed in T. brucei, the protein is imported into the glycosomes.…”

Section: Simultaneous Expression Of Luciferase and Neo In T Brucei Bmentioning

confidence: 99%

“…It is thus not clear whether the tripeptide sequences mentioned above are either required or sufficient for the import of proteins into the glycosomes of T. brucei. To test whether SKL can target a cytoplasmic protein to the glycosome, Fung and Clayton (1991) have added an SKL-tripeptide to the C-terminus of chloramphenicol acetyltransferase (CAT), and this protein was expressed transiently in T. brucei. Some of the CAT activity indeed copurified with glycosomal markers on a sucrose density gradient, but the inefficiency of the transient transformation system did not allow electron microscopic verification that the modified CAT protein was actually imported into the matrix of T. brucei glycosomes.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

In vivo import of firefly luciferase into the glycosomes of Trypanosoma brucei and mutational analysis of the C-terminal targeting signal.

Sommer

Cheng

Keller

et al. 1992

MBoC

147

107

View full text Add to dashboard Cite

The compartmentalization of glycolytic enzymes into specialized organelles, the glycosomes, allows the bloodstream form of Trypanosoma brucei to rely solely on glycolysis for its energy production. The biogenesis of glycosomes in these parasites has been studied intensively as a potential target for chemotherapy. We have adapted the recently developed methods for stable transformation of T. brucei to the in vivo analysis of glycosomal protein import. Firefly luciferase, a peroxisomal protein in the lantern of the insect, was expressed in stable transformants of the procyclic form of T. brucei, where it was found to accumulate inside the glycosomes. Mutational analysis of the peroxisomal targeting signal serine-lysine-leucine (SKL) located at the C-terminus of luciferase showed that replacement of the serine residue (Serine548) with a small neutral amino acid (A, C, G, H, N, P, T) still resulted in an import efficiency of 50-100% of the wild-type luciferase. Lysine549 could be substituted with an amino acid capable of hydrogen bonding (H, M, N, Q, R, S), whereas the C-terminal leucine550 could be replaced with a subset of hydrophobic amino acids (I, M, Y). Thus, a peroxisome-like C-terminal SKL-dependent targeting mechanism may function in T. brucei to import luciferase into the glycosomes. However, a few significant differences exist between the glycosomal targeting signals identified here and the tripeptide sequences that direct proteins to mammalian or yeast peroxisomes.

show abstract

Section: Simultaneous Expression Of Luciferase and Neo In T Brucei Bmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

In vivo import of firefly luciferase into the glycosomes of Trypanosoma brucei and mutational analysis of the C-terminal targeting signal.

Sommer

Cheng

Keller

et al. 1992

MBoC

147

107

View full text Add to dashboard Cite

show abstract

“…3). The CAT activity at the top of the gradient is also seen when the pellet fraction of trypanosomes transfected with CAT without a glycosomal signal is assayed [20]. It is presumably due to a combination of leakage and material adhering to the outside of the organelles.…”

Section: Function Of the Pts-2 In Glycosomal Targetingmentioning

confidence: 86%

“…The hybrid gene contains a unique XhoI site (encoding a leucine residue) at the junction point between the aldolase and CAT sequences. It was digested with HindlII and BamHI and cloned into pJP62 [20] cut with the same enzymes. The vectors pHD436, pHD438 and pHD456 were generated by PCR amplification of aldolase 5' fragments with genomic DNA of the AnTatl.1 strain as template, using the 5' primer CZ031 and 3' primers CZ354 5'GGCTACTCGAGACCCTTACCGGGGGC3', CZ365 5'GGCTACTCGAGTTGGGTAAGCAGAAC3' and CZ353 5'GGCTACTCGAGCTCCGCTTCATATGG3' respectively, followed by cloning of the amplified fragments into pAldE via their HindlII and XhoI sites.…”

Section: Plasmid Constructionsmentioning

confidence: 99%

See 1 more Smart Citation

Function of N‐terminal import signals in trypanosome microbodies

1995

View full text Add to dashboard Cite

The glycosomes of trypanosomes are related to eukaryotic peroxisomes. For many glycosomal and peroxisomal proteins, a C-terminal SKL-like tripeptide known as PTS-1 serves as the targeting signal. For peroxisomes, a second N-terminal signal (PTS-2) was demonstrated on rat 3-ketoacyl-CoA thiolase. Several glycosomal proteins do not bear a PTS-1. One such protein, fructose bisphosphate aldolase, has a PTS-2 homology at its N-terminus. To find out whether the PTS-2 pathway exists in trypanosomes, we expressed chloramphenicol acetyltransferase fusion proteins bearing N-terminal segments of either rat thiolase or trypanosome aldolase. The mammalian PTS-2 clearly mediated glycosomal import. The aldolase N-terminus mediated import with variable efficiency depending on the length of the appended sequence. These results provide evidence for the existence of the PTS-2 pathway in trypanosomes.

show abstract

Targeting signals for protein import into peroxisomes

Roggenkamp

1992

Cell Biochemistry & Function

View full text Add to dashboard Cite

Recognition of a peroxisomal tripeptide entry signal by the glycosomes of Trypanosoma brucei

Cited by 57 publications

References 17 publications

In vivo import of firefly luciferase into the glycosomes of Trypanosoma brucei and mutational analysis of the C-terminal targeting signal.

In vivo import of firefly luciferase into the glycosomes of Trypanosoma brucei and mutational analysis of the C-terminal targeting signal.

Function of N‐terminal import signals in trypanosome microbodies

Targeting signals for protein import into peroxisomes

Contact Info

Product

Resources

About