Reconstitution and use of highly active human CDK1:Cyclin‐B:CKS1 complexes

Abstract

As dividing cells transition into mitosis, hundreds of proteins are phosphorylated by a complex of cyclin‐dependent kinase 1 (CDK1) and Cyclin‐B, often at multiple sites. CDK1:Cyclin‐B phosphorylation patterns alter conformations, interaction partners, and enzymatic activities of target proteins and need to be recapitulated in vitro for the structural and functional characterization of the mitotic protein machinery. This requires a pure and active recombinant kinase complex. The kinase activity of CDK1 critically depends on the phosphorylation of a Threonine residue in its activation loop by a CDK1‐activating kinase (CAK). We developed protocols to activate CDK1:Cyclin‐B either in vitro with purified CAKs or in insect cells through CDK‐CAK co‐expression. To boost kinase processivity, we reconstituted a ternary complex consisting of CDK1, Cyclin‐B, and CKS1. In this work, we provide and compare detailed protocols to obtain and use highly active CDK1:Cyclin‐B (CC) and CDK1:Cyclin‐B:CKS1 (CCC).

Transcriptomic Modulation Reveals the Specific Cellular Response in Chinese Sea Bass (Lateolabrax maculatus) Gills under Salinity Change and Alkalinity Stress

“…Moreover, “cell cycle” related functions were also inhibited in the AW-down DEGs. For instance, G2/mitotic-specific cyclin-B (CCNB1, CCNB2) is essential for the control of the cell cycle at the G2/M (mitosis) transition [ 55 ], DNA replication licensing factor (MCM2, MCM4) is the replicative helicase essential for ‘once per cell cycle’ DNA replication initiation and elongation in eukaryotic cells [ 56 ]. In addition, cellular structure-related functions such as “actin filament”, “myosin complex” and “cytoskeleton” were enriched including myosin (MYL1, MYL3, MYH7, MYLPF), actin (ACTA1, ACTC1) and troponin (TNNC2, TNNT3, TNNI1) genes inhibited and correlated in the network ( Figure 4 and Figure S5c ), indicating the inhibition of intracellular movements and membrane trafficking in gill filament due to alkalinity stress [ 57 ].…”

Phosphate-binding pocket on cyclin B governs CDK substrate phosphorylation and mitotic timing

“…Wild-type and mutant human Cdk1-cyclin B1 complexes were expressed from recombinant baculoviruses and purified as previously described 59 . Human Cks1 was expressed from a recombinant baculovirus encoding a His-TEV-Cks1 fusion, and purified as described 60 with the following modifications. In brief, 800 ml of infected SF-900 cells were harvested and resuspended in buffer A (50 mM HEPES pH 7.4, 250 mM NaCl, 15 mM imidazole, 2 mM TCEP, 5% glycerol) supplemented with 250 U of Benzonase and 1 cOmplete Protease Inhibitor Tablet.…”

Phosphoproteomics identifies targets of Mos-MAPK regulating translation and spindle organization in oocyte meiosis

“…To test this directly, we injected active Cdk1-Cyclin B complex (Veld et al, 2021) shortly after metaphase I into oocytes treated with U0126. As shown above, U0126 treatment prevents transition to MII, and oocytes exit after MI, form a pronucleus and enter parthenogenetic development (Fig 4D).…”

“…Anti-cyclin B morpholino TAACCAATGCGAGTTCCGAGGAG (Gene Tools), was injected at 500 mM final concentration immediately before 1-MA stimulation (Swartz et al, 2021). Active Cdk1-Cyclin B complex was a generous gift from Pim J. Huis in't Veld and Andrea Musacchio (MPI for Molecular Physiology, Dortmund, Germany) (Veld et al, 2021). In order to remove glycerol, the complex was purified through a 10K MWCO protein concentrator (Pierce) and dissolved in PBS with 200 mM sucrose.…”