Recurrent Fusion of TMPRSS2 and ETS Transcription Factor Genes in Prostate Cancer

TMPRSS2:ERG gene fusion associated with lethal prostate cancer in a watchful waiting cohort

“…Thus, 86% of prostate cancer cases with high ERG expression in this subset had the TMPRSS2:ERG fusion. This result confirms our previous finding where 19 of 20 prostate cancer cases with ERG overexpression were shown to have TMPRSS2:ERG rearrangement by sequencing (Tomlins et al, 2005).…”

“…Based on the homogeneity of the TMPRSS2:ERG fusion in cells in a given tumor (Perner et al, 2006) and its presence in invasive prostate cancer and approximately 20% of high-grade prostate cancer with associated gene fusion (Perner et al, in press), we believe this to be an early event. To assess the association of ERG overexpression with gene fusion in this population-based cohort, we performed QPCR for the ERG gene (ERG f: exon 5-6, CGCAGAGTTATCGTGCCAGCAGAT and ERG r: exon 5-6, CCATATTCTTTCACCGCCCACTCC) as described recently (Tomlins et al, 2005), in a subset of 28 cases. High ERG expression was seen in 12/12 TMPRSS2:ERG fusion prostate cancers in contrast to 2/ 16 prostate cancers without TMPRSS2:ERG fusion (Po0.0005) (Figure 2).…”

“…This FISH assay is an indirect test and therefore cannot directly confirm fusion of TMPRSS2:ERG (see Supplementary materials for details). However, as we previously reported (Tomlins et al, 2005), 5 0 RNA ligase-mediated rapid amplification of cDNA ends (RLM-RACE) analysis and sequencing of the reverse-transcription-polymerase chain reaction (RT-PCR) product from prostate cancer cases with ERG over expression revealed a fusion of TMPRSS2 with ERG by quantitative PCR (QPCR) and/or RACE. This demonstrates that almost all prostate cancer samples with marked overexpression of ERG have a rearrangement, and the overexpression occurs in about the same number of cases as the rearrangement.…”

“…Thus, the acceptance of expectant therapy hinges on accurate risk assessment for prostate cancer disease progression. The identification of the TMPRSS2:ETS fusion in prostate cancer suggests that distinct molecular subtypes may further define risk for disease progression (Tomlins et al, 2005;Soller et al, 2006). The most common gene fusion is TMPRSS2:ERG found in approximately 50% of the surgical-based cohorts studied to date.…”

“…In early studies, the gene fusions of the 5 0 -untranslated region of TMPRSS2 (21q22.3) with the ETS transcription factor family members, estrogen-regulated gene (ERG) (21q22.2), ETV1 (7p21.2) (Tomlins et al, 2005), or ETV4 (Tomlins et al, 2006) provide a mechanism for the overexpression of the ETS genes in prostate cancers. Furthermore, the fusion of an androgen-regulated gene, TMPRSS2, and an oncogene suggests that disease progression may vary based on these molecular subtypes.…”