Reduced Expression of Perlecan in the Aorta of Secondary Hyperparathyroidism Model Rats with Medial Calcification

Shibata, Maki; Sügimura, Takashi; Hatamura, Ikuji; Saji, Fumie; Mune, Sachiko; Kunimoto, Kayo; Hanba, Yoshiyuki; Shiizaki, Kazuhiro; Sakaguchi, Toshifumi; Negi, Shigeo

doi:10.3109/08860220903367544

Cited by 10 publications

(22 citation statements)

References 33 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Consistent with this idea, proteoglycans and HS can function as potent inhibitors of hydroxyapatite formation [24, 25]. Interestingly, reduced levels of Pln also were found to be associated with vascular calcification of smooth muscle cells in the aorta of an experimental rat model [26], suggesting that Pln interaction with factors that promote calcification can protect various tissue types from pathological mineralization. Furthermore, recent data consistent with this study showed that Pln deficiency is associated with a decrease in osteocytes’ pericellular space which suggested that Pln and its HS chains prevent tissue mineralization [17].…”

Section: Discussionmentioning

confidence: 88%

Deficiency in Perlecan/HSPG2 During Bone Development Enhances Osteogenesis and Decreases Quality of Adult Bone in Mice

et al. 2014

View full text Add to dashboard Cite

Perlecan/Hspg2 (Pln) is a large heparan sulfate proteoglycan abundant in the extracellular matrix of cartilage and the lacuno-canalicular space of adult bones. While Pln function during cartilage development is critical, evidenced by deficiency disorders including Schwartz-Jampel Syndrome and dyssegmental dysplasia Silverman-Handmaker type, little is known about its function in development of bone shape and quality. The purpose of this study was to understand the contribution of Pln to bone geometric and mechanical properties. We used hypomorph mutant mice that secrete negligible amount of Pln into skeletal tissues and analyzed their adult bone properties using micro-computed tomography and three-point-bending tests. Bone shortening and widening in Pln mutants was observed and could be attributed to loss of growth plate organization and accelerated osteogenesis that was reflected by elevated cortical thickness at older ages. This effect was more pronounced in Pln mutant females indicating a gender-specific effect of Pln deficiency on bone geometry. Additionally, mutant females, and to a lesser extent mutant males, increased their elastic modulus and bone mineral densities to counteract changes in bone shape, but at the expense of increased brittleness. In summary, Pln deficiency alters cartilage matrix patterning and, as we now show, coordinately influences bone formation and calcification.

show abstract

Section: Discussionmentioning

confidence: 88%

Deficiency in Perlecan/HSPG2 During Bone Development Enhances Osteogenesis and Decreases Quality of Adult Bone in Mice

et al. 2014

View full text Add to dashboard Cite

show abstract

“…Standard curves for rHspg2 and rGAPDH exhibited similar slopes, allowing GAPDH‐normalized gene expression levels to be determined using the ΔΔCt method. Primers sets included rGAPDH: Forward, CCAGC CTCGTCTCATAG; Reverse, ACTTGCCGTGGGTAG AGTC, and rHspg2: Forward, CCCTGGCAACAGCTTCTCTA; Reverse, ATGGCCATCCTGTAGTCCAA. All assays were run in triplicate.…”

Section: Methodsmentioning

confidence: 99%

Maternal protein restriction reduces perlecan at mid‐metanephrogenesis in rats

et al. 2016

View full text Add to dashboard Cite

show abstract

“…3.2.1. Low Molecular Weight Substances, Increased in Blood in CKD (Table 1) A high ambient phosphate concentration triggers calcification in a variety of situations, as shown in vitro in human VSMC [29,30,[32][33][34], rat and mouse VSMC [35,36], rat aortic rings [33], as well as in aortas of rats subjected to 5/6 nephrectomy [35]. Apo −/− mice with 5/6 nephrectomy displayed aortic valve calcification 12 weeks after surgery both when fed a high phosphate diet as well as a control diet, though with increased calcium deposits detected upon high phosphate diet [36].…”

Section: Effect Of the Identified Substances On Cardiovascular Calcifmentioning

confidence: 99%

“…The calcium-phosphate metabolism is one of the key factors for initiation and progression of vascular calcification in CKD [60] and in vitro as well as ex vivo studies showed increased calcification upon increased levels of calcium [38,40] or inorganic phosphate [29,32,33,35]. In late stage CKD (CKD 4-5), most of CKD patients present with hyperphosphatemia [61,62].…”

Section: Mechanisms and Signalling Pathways Associating Uremic Toxinsmentioning

confidence: 99%

Uremic Toxins Affecting Cardiovascular Calcification: A Systematic Review

Holmar

Puente-Secades

Floege

et al. 2020

Cells

View full text Add to dashboard Cite

Cardiovascular calcification is highly prevalent and associated with increased morbidity in chronic kidney disease (CKD). This review examines the impact of uremic toxins, which accumulate in CKD due to a failing kidney function, on cardiovascular calcification. A systematic literature search identified 41 uremic toxins that have been studied in relation to cardiovascular calcification. For 29 substances, a potentially causal role in cardiovascular calcification was addressed in in vitro or animal studies. A calcification-inducing effect was revealed for 16 substances, whereas for three uremic toxins, namely the guanidino compounds asymmetric and symmetric dimethylarginine, as well as guanidinosuccinic acid, a calcification inhibitory effect was identified in vitro. At a mechanistic level, effects of uremic toxins on calcification could be linked to the induction of inflammation or oxidative stress, smooth muscle cell osteogenic transdifferentiation and/or apoptosis, or alkaline phosphatase activity. For all middle molecular weight and protein-bound uremic toxins that were found to affect cardiovascular calcification, an increasing effect on calcification was revealed, supporting the need to focus on an increased removal efficiency of these uremic toxin classes in dialysis. In conclusion, of all uremic toxins studied with respect to calcification regulatory effects to date, more uremic toxins promote rather than reduce cardiovascular calcification processes. Additionally, it highlights that only a relatively small part of uremic toxins has been screened for effects on calcification, supporting further investigation of uremic toxins, as well as of associated post-translational modifications, on cardiovascular calcification processes.

show abstract

Reduced Expression of Perlecan in the Aorta of Secondary Hyperparathyroidism Model Rats with Medial Calcification

Abstract: It may be that reduced expression of perlecan in the calcified aortae of hyperparathyroid rats is a risk factor for vascular calcification.

Cited by 10 publications

References 33 publications

Deficiency in Perlecan/HSPG2 During Bone Development Enhances Osteogenesis and Decreases Quality of Adult Bone in Mice

Deficiency in Perlecan/HSPG2 During Bone Development Enhances Osteogenesis and Decreases Quality of Adult Bone in Mice

Maternal protein restriction reduces perlecan at mid‐metanephrogenesis in rats

Uremic Toxins Affecting Cardiovascular Calcification: A Systematic Review

Contact Info

Product

Resources

About