Reference gene selection for normalization of PCR analysis in chicken embryo fibroblast infected with H5N1 AIV

Abstract

Chicken embryo fibroblasts (CEFs) are among the most commonly used cells for the study of interactions between chicken hosts and H5N1 avian influenza virus (AIV). In this study, the expression of eleven housekeeping genes typically used for the normalization of quantitative real-time PCR (QPCR) analysis in mammals were compared in CEFs infected with H5N1 AIV to determine the most reliable reference genes in this system. CEFs cultured from 10-day-old SPF chicken embryos were infected with 100 TCID(50) of H5N1 AIV and harvested at 3, 12, 24 and 30 hours post-infection. The expression levels of the eleven reference genes in infected and uninfected CEFs were determined by real-time PCR. Based on expression stability and expression levels, our data suggest that the ribosomal protein L4 (RPL4) and tyrosine 3-monooxygenase tryptophan 5-monooxygenase activation protein zeta polypeptide (YWHAZ) are the best reference genes to use in the study of host cell response to H5N1 AIV infection. However, for the study of replication levels of H5N1 AIV in CEFs, the β-actin gene (ACTB) and the ribosomal protein L4 (RPL4) gene are the best references.

The normalisation ofCAPNgene expression inM. pectoralis superficialisin broiler lines differing in growth rate and their relationship to breast muscle tenderness

“…All of the investigated genes -except ALB -could be useful as ICG, because all of them had an M factor below 1.5. Similar results were obtained by Yue et al (2010), who found the M Values in the same row with no common superscript letter differ significantly (P ≤ 0.05).…”

“…This suggests that the stability of the investigated internal control genes is dependent on species. The best result was obtained for the RPL4 gene, confirming an earlier report where the authors chose the RPL4 and YWHAZ genes as the most appropriate for normalising gene expression in embryo fibroblast cultures (Yue et al, 2010). Also, the RPS9 and RPL27 genes were used as housekeeping genes in expression analysis in pigs (Janovick-Guretzky et al, 2007;Oczkowicz et al, 2010).…”

“…The matching of the most stable endogenous genes is a critical point of gene expression research. A total of 9 recommended endogenous genes were tested which were used successfully in previous studies in chickens or in other species (Wang et al, 2006;Yue et al, 2010;Piórkowska et al, 2011). All of the investigated genes -except ALB -could be useful as ICG, because all of them had an M factor below 1.5.…”

“…ACTB, HPRT1, GAPDH, OAZ1, RPL27 and TBP are commonly used as reference genes in gene expression studies of other species (Wang et al, 2006;Oczkowicz et al, 2010), whereas RPL4, ALB and SDHA were used in a study of interactions between chicken hosts and H5N1 avian influenza virus (AIV) (Yue et al, 2010). The primers and probes for endogenous control were designed by Applied Biosystems and purchased as a mix (assay) ( Table 1).…”

The FACT Complex Promotes Avian Leukosis Virus DNA Integration

“…Quantitative PCRs were performed with the CFX96 real-time system (Bio-Rad) and prepared using iQ SYBR green Supermix (Bio-Rad). Expression levels of SSRP1 (primers GGCTCACCAAGAACATGTCA and AGTCCTGAGCTGGCCTTGTA) were normalized to RPL30 (60).…”