Regulation of hypoxia‐inducible factor functions in the nucleus by sphingosine‐1‐phosphate

Newman

Tokumaru

et al. 2020

IJMS

Self Cite

Angiogenesis is one of the hallmarks of cancer. We hypothesized that intra-tumoral angiogenesis correlates with inflammation and metastasis in breast cancer patients. To test this hypothesis, we generated an angiogenesis pathway score using gene set variation analysis and analyzed the tumor transcriptome of 3999 breast cancer patients from The Cancer Genome Atlas Breast Cancer (TCGA-BRCA), Molecular Taxonomy of Breast Cancer International Consortium (METABRIC), GSE20194, GSE25066, GSE32646, and GSE2034 cohorts. We found that the score correlated with expression of various angiogenesis-, vascular stability-, and sphingosine-1-phosphate (S1P)-related genes. Surprisingly, the angiogenesis score was not associated with breast cancer subtype, Nottingham pathological grade, clinical stage, response to neoadjuvant chemotherapy, or patient survival. However, a high score was associated with a low fraction of both favorable and unfavorable immune cell infiltrations except for dendritic cell and M2 macrophage, and with Leukocyte Fraction, Tumor Infiltrating Lymphocyte Regional Fraction and Lymphocyte Infiltration Signature scores. High-score tumors had significant enrichment for unfavorable inflammation-related gene sets (interleukin (IL)6, and tumor necrosis factor (TNF)α- and TGFβ-signaling), as well as metastasis-related gene sets (epithelial mesenchymal transition, and Hedgehog-, Notch-, and WNT-signaling). High score was significantly associated with metastatic recurrence particularly to brain and bone. In conclusion, using the angiogenesis pathway score, we found that intra-tumoral angiogenesis is associated with immune reaction, inflammation and metastasis-related pathways, and metastatic recurrence in breast cancer.

Section: Discussionsupporting

confidence: 92%

Intra-Tumoral Angiogenesis Is Associated with Inflammation, Immune Reaction and Metastatic Recurrence in Breast Cancer

Newman

Tokumaru

et al. 2020

IJMS

Self Cite

“…USA. Both the cell lines were cultured and maintained in α-MEM supplemented with 10% fetal bovine serum, 1 mM Penicillin/Streptomycin, and 1 mM sodium pyruvate at 37°C in 5% CO2 and 95% humidity, as mentioned before (67)(68)(69).…”

Section: Discussionmentioning

confidence: 99%

“…RNA-seq libraries were prepared using TruSeq Stranded Total RNA Library Prep Gold kit (Illumina, San Diego, CA, USA). The quality of the libraries was validated by assaying using TapeStation D1000 ScreenTape According to the manufacturer's instructions, as described before (67)(68)(69)74), cDNA was synthesized from DNase pre-treated 1 μg RNA using the SuperScript cDNA Synthesis kit (Life Technologies, Carlsbad, CA, USA). The PCR reaction was performed by the thermal cycler (Bio-Rad, Hercules, CA, USA) using SYBR Green qPCR SuperMixes with PCR primers for the mouse Primary tumors and the metastatic lesions of the distant organs were used for molecular analyses.…”

Section: Rna Preparation and Rna-seqmentioning

confidence: 99%

Altered Expression of Secreted Mediator Genes That Mediate Aggressive Breast Cancer Metastasis to Distant Organs

Maiti

Okano

et al. 2020

Preprint

Self Cite

Breast cancer most often recurs and metastasizes to the distal organs with their primary tumors surgically excised. Due to the heterogeneous nature of breast cancer, metastasis organotropism has poorly understood. This study assessed the specific cancer-related gene expression changes occurring with metastatic breast cancer recurrence to distant organs compared with non-metastatic breast cancer. We found that secreted mediators encoding genes (ANGPTL7, MMP3, LCN2, S100A8, and ESM1) are upregulated in primary breast tumors of 4T1.2, a highly metastatic variant of mouse triple-negative breast cancer (TNBC) 4T1 cells. Those genes are variably expressed at distant metastatic sites such as the spine, bone, and the lung in the syngeneic implantation/tumor-resection metastasis mouse model. The altered expression score of an individual gene was strongly associated with the survival of breast cancer patients. Notably, LCN2 and S100A8 overexpressed at the distant metastatic site spine (LCN2, 5 fold; S100A8, 6 fold) and bone (LCN2, 5 fold; S100A8, 3 fold) vs. primary tumors. In contrast, the ESM-1 encoding gene is overexpressed in the primary tumors and markedly downregulated at distant metastatic sites such as the spine, bone, and the lung. LCN2, S100A8, and ESM-1 mediators encoding individual gene expression scores were strongly associated with disease-specific survival (DSS) in the METABRIC cohort (hazard ratio [HR]>1, p < 0.0004). The gene expression scores predicted worse clinically aggressive tumors, such as high Nottingham histological grade and advanced cancer staging. High gene expression score of ESM-1 gene was strongly associated with worse overall survival (OS) in the triple-negative breast cancer (TNBC) and hormonal receptor (HR)-positive/Her2-negative subtype in METABRIC cohort, HER2+ subtype in TCGA-BRCA and SCAN-B breast cancer cohorts.Our data suggested that mediators encoding genes with both prognostic and predictive values may, therefore, be clinically useful for breast cancer spine, bone, and lung metastasis in particularly in more aggressive subtypes such as TNBC or HER2+ breast cancer.

“…The 4T1-Luc+ mouse breast cancer cell line and the 4T1.2-Luc+ metastatic variant of 4T1 parental cell line [ 12 ] were kindly provided by Prof. Cheryl L. Jorcyk of Boise State University, Department of Biological Sciences, Biomolecular Sciences Program, 1910 University Drive, Boise, ID, 83725, USA. Both the cell lines were cultured and maintained in α-MEM supplemented with 10% fetal bovine serum, 1 mM Penicillin/Streptomycin, and 1 mM sodium pyruvate at 37 °C in 5% CO 2 and 95% humidity, as mentioned before [ 79 , 80 , 81 ].…”

Section: Methodsmentioning

confidence: 99%

“…According to the manufacturer’s instructions, as described before [ 79 , 80 , 81 , 86 ], cDNA was synthesized from DNase pre-treated 1 μg RNA using the SuperScript cDNA Synthesis kit (Life Technologies, Carlsbad, CA, USA). The PCR reaction was performed by the thermal cycler (Bio-Rad, Hercules, CA, USA) using SYBR Green qPCR SuperMixes with PCR primers for the mouse (ANGPTL7: F- TGACTGTTCTTCCCTGTACCA, R- CAAGGCCACTCTTACGTCTCT; MMP3: F- ACATGGAGACTTTGTCCCTTTTG, R- TTGGCTGAGTGGTAGAGTCCC; LCN2: F- TGGCCCTGAGTGTCATGTG, R- CTCTTGTAGCTCATAGATGGTGC; S100A8: F- AAATCACCATGCCCTCTACAAG, R- CCCACTTTTATCACCATCGCAA; ESM-1: F- CTGGAGCGCCAAATATGCG, R- TGAGACTGTACGGTAGCAGGT; GAPDH: F- TGGATTTGGACGCATTGGTC, R- TTTGCACTGGTACGTGTTGAT).…”

Section: Methodsmentioning

confidence: 99%

Altered Expression of Secreted Mediator Genes That Mediate Aggressive Breast Cancer Metastasis to Distant Organs

Maiti

Okano

et al. 2021

Cancers

Self Cite

Heterogeneity is the characteristic of breast tumors, making it difficult to understand the molecular mechanism. Alteration of gene expression in the primary tumor versus the metastatic lesion remains challenging for getting any specific targeted therapy. To better understand how gene expression profile changes during metastasis, we compare the primary tumor and distant metastatic tumor gene expression using primary breast tumors compared with its metastatic variant in animal models. Our RNA sequencing data from cells revealed that parental cell and the metastatic variant cell are different in gene expression while gene signature significantly altered during metastasis to distant organs than primary breast tumors. We found that secreted mediators encoding genes (ANGPTL7, MMP3, LCN2, S100A8, and ESM1) are correlated with poor prognosis in the clinical setting as divulged from METABRIC and TCGA-BRCA cohort data analysis.