Regulation of Src tumor activity by its N-terminal intrinsically disordered region

Aponte, Emilie; Lafitte, Marianne; Sirvent, Audrey; Simon, Valérie; Barbery, Maud; Fourgous, Elise; Boublik, Yvan; Maffei, Mariano; Armand, Florence; Hamelin, Romain; Pannequin, Julie; Fort, Philippe; Pons, Miquel; Roche, Serge

doi:10.1038/s41388-021-02092-x

Cited by 13 publications

(11 citation statements)

References 43 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We tested the effect of the 3R mutation in the context of full-length c-Src. To test in cell dimerization, wild type human c-Src and the 3R mutants were fused with FLAG and Myc tags at the C-terminus as described previously (6), and the various combinations of mutated or wild type proteins with the two tags were co-expressed in HEK293T cells. After cell lysis, proteins containing the FLAG tag were immunoprecipitated and tested for the co-precipitation of Myc-tagged c-Src (Fig.…”

Section: Resultsmentioning

confidence: 99%

“…PcDNA3 vectors expressing human Src-myc and Src-Flag were described in (Aponte et al (6)). pcDNA3-Src K5R/K7R/K9R (Src 3R) mutants were obtained by PCR using the QuickChange Site-Directed Mutagenesis Kit (Stratagene); forward 5’:CCCTTCACCATGGGTAGCAACAGGAGCAGGCCCAGGGATGCCAGCCAGCGGCGCCGC, reverse 5’:GCGGCGCCGCTGGCTGGCATCCCTGGGCCTGCTCCTGTTGCTACCCATGGTGAAGGG.…”

Section: Methodsmentioning

confidence: 99%

“…pcDNA3-Src K5R/K7R/K9R (Src 3R) mutants were obtained by PCR using the QuickChange Site-Directed Mutagenesis Kit (Stratagene); forward 5’:CCCTTCACCATGGGTAGCAACAGGAGCAGGCCCAGGGATGCCAGCCAGCGGCGCCGC, reverse 5’:GCGGCGCCGCTGGCTGGCATCCCTGGGCCTGCTCCTGTTGCTACCCATGGTGAAGGG. HEK293T cells (ATCC, Rockville, MD) were cultured and transfected with indicated Src constructs for 24h as described (Aponte et al (6)). Immunoprecipitation and immunoblotting of Src proteins were performed as described in (Aponte et al (6)) by using anti-Flag coupled beads (Pierce, #A36797) for Src precipitation and anti-Flag (M2, Sigma) and anti-Myc (9B11, Ozyme) antibodies for Src immunoblotting.…”

Section: Methodsmentioning

confidence: 99%

“…HEK293T cells (ATCC, Rockville, MD) were cultured and transfected with indicated Src constructs for 24h as described (Aponte et al (6)). Immunoprecipitation and immunoblotting of Src proteins were performed as described in (Aponte et al (6)) by using anti-Flag coupled beads (Pierce, #A36797) for Src precipitation and anti-Flag (M2, Sigma) and anti-Myc (9B11, Ozyme) antibodies for Src immunoblotting. Cellular protein tyrosine phosphorylation was performed by immunoblotting of total cell lysate (20 μg) using anti-pTyr antibody (4G10, a gift form Prof. Mangeat; CRBM) and anti-Actin (Cell Signaling Technology).…”

Section: Methodsmentioning

confidence: 99%

“…The key feature of the SNRE is the arrangement of an interdomain fuzzy complex in which the disordered SH4 and Unique domains are condensed around the SH3 domain, while retaining the extensive dynamics typical of intrinsically disordered regions (4,5). In human colon rectal cancer cells, the SNRE has been revealed to have a relevant role in the c-Src mediated oncogenic signaling (6). All SFK members are anchored to membranes through the N-terminal myristoylated SH4 domain.…”

Section: Introductionmentioning

confidence: 99%

See 4 more Smart Citations

Lipid-mediated dimerization of membrane-anchored c-Src is driven by a cluster of lysine residues in the N-terminal SH4 domain

Mohammad¹,

Carvajal²,

Fernández³

et al. 2022

Preprint

Self Cite

View full text Add to dashboard Cite

The membrane-anchored c-Src tyrosine kinase mediates signaling from a wide range of cell surface receptors controlling cell growth, adhesion, and survival. c-Src deregulation is associated with cancer. Dimerization appears to be a novel layer of regulation through a yet unclear mechanism. Binding of c-Src tyrosine kinase to the plasma membrane is mediated by the myristoylated and strongly positively charged N-terminal SH4 domain. Although activation of c-Src is known to require phosphorylation by a second c-Src molecule, electrostatic repulsion between the charged residues was considered to prevent dimerization. Here we show that a cluster of positively charged lysine residues in c-Src SH4 domain not only does not prevent dimerization but, in fact, enhances it through a lipid-mediated process. Dimerization not only depends on the number of positive charges but also on their position and the nature of the charged residues. Replacement of lysine by arginine increases dimerization in vitro and in vivo and, in HEK293T cells, causes a two-fold increase in tyrosine phosphorylation. Lipid mediated protein-protein interactions induced by clusters of basic residues may represent a general mechanism for modulating cell signaling, consistent with the abundance of positively charged residues in the juxta membrane region of many signaling proteins.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%