Remodeling of YeastCUP1Chromatin Involves Activator-Dependent Repositioning of Nucleosomes over the Entire Gene and Flanking Sequences

Abstract

The yeast CUP1 gene is activated by the copper-dependent binding of the transcriptional activator, Ace1p. An episome containing transcriptionally active or inactive CUP1 was purified in its native chromatin structure from yeast cells. The amount of RNA polymerase II on CUP1 in the purified episomes correlated with its transcriptional activity in vivo. Chromatin structures were examined by using the monomer extension technique to map translational positions of nucleosomes. The chromatin structure of an episome containing inactive CUP1 isolated from ace1⌬ cells is organized into clusters of overlapping nucleosome positions separated by linkers. Novel nucleosome positions that include the linkers are occupied in the presence of Ace1p. Repositioning was observed over the entire CUP1 gene and its flanking regions, possibly over the entire episome. Mutation of the TATA boxes to prevent transcription did not prevent repositioning, implicating a chromatin remodeling activity recruited by Ace1p. These observations provide direct evidence in vivo for the nucleosome sliding mechanism proposed for remodeling complexes in vitro and indicate that remodeling is not restricted to the promoter but occurs over a chromatin domain including CUP1 and its flanking sequences.

Chromatin-dependent Transcription Factor Accessibility Rather than Nucleosome Remodeling Predominates during Global Transcriptional Restructuring in Saccharomyces cerevisiae

“…However, we still do not understand why TATA-containing boxes are associated with promoter remodeling. The TATA box itself does not seem to be required for nucleosome remodeling, as mutant PHO5, SUC2, and CUP1 promoters that lack TATA boxes still undergo wild type nucleosome remodeling (Hirschhorn et al, 1992;Fascher et al, 1993;Shen et al, 2001). Moreover, artificial recruitment of TBP to several remodeling promoters is not sufficient to initiate nucleosome remodeling (Ryan et al, 2000).…”

“…Consistent with this notion, several examples have been reported in which gene induction involves recruitment to a promoter of chromatin remodeling factors and histone modifying activities designed to remove or reposition a nucleosome to allow access to an otherwise masked transcription factor binding site (Li et al, 2007;Williams and Tyler, 2007). For example, remodeling factors act at the above-mentioned promoters for PHO5, GAL1, CUP1, and SUC2 to facilitate nucleosome loss on transcriptional activation and conversely to assemble or stabilize nucleosomes on the gene promoter during transcriptional repression (Almer et al, 1986;Fedor and Kornberg, 1989;Shen et al, 2001;Kim et al, 2006).…”

“…Consistent with this notion, several examples have been reported in which gene induction involves recruitment to a promoter of chromatin remodeling factors and histone modifying activities designed to remove or reposition a nucleosome to allow access to an otherwise masked transcription factor binding site (Li et al, 2007;Williams and Tyler, 2007). For example, remodeling factors act at the above-mentioned promoters for PHO5, GAL1, CUP1, and SUC2 to facilitate nucleosome loss on transcriptional activation and conversely to assemble or stabilize nucleosomes on the gene promoter during transcriptional repression (Almer et al, 1986;Fedor and Kornberg, 1989;Shen et al, 2001;Kim et al, 2006).Chromatin can also play a more passive role in gene regulation by simply controlling which transcription factor binding sites are available for participation in gene regulation. Recent genome-wide studies of nucleosome positioning found that most yeast promoters contain an extended nucleosome-depleted region (NDR) that is enriched for transcription factor binding sites (Lee et al, 2004;Yuan et al, 2005;Lee et al, 2007;Mavrich et al, 2008;Shivaswamy et al, 2008).…”

A SWI/SNF- and INO80-dependent nucleosome movement at the INO1 promoter

“…Total RNA was prepared from collected cells as described previously (28). Equal amounts (3 µg) of RNA were used in the Northern blots as described previously (28). The INO1 probe was a 459-bp PCR fragment (forward primer: TAATATTGCTCCAATCACCTCC; reverse primer: GCTTCGTATAGATCTGCGTTAT) and the ACT1 probe was a 269-bp PCR fragment (forward primer: ATGGATTCTGGTATGTTCTAGC; reverse primer: CATGAGACTTAGTAACAGTAGC).…”

“…For the ino80Δ strain, cells were washed in SC-trp-ino, and inoculated in either SC-trp or SC-trp-ino. Total RNA was prepared from collected cells as described previously (28). Equal amounts (3 µg) of RNA were used in the Northern blots as described previously (28).…”