Removal of senescent cells reduces the viral load and attenuates pulmonary and systemic inflammation in SARS-CoV-2-infected, aged hamsters

Abstract

Older age is one of the strongest risk factors for severe COVID-19. In this study, we determined whether age-associated cellular senescence contributes to the severity of experimental COVID-19. Aged golden hamsters accumulate senescent cells in the lungs, and the senolytic drug ABT-263, a BCL-2 inhibitor, depletes these cells at baseline and during SARS-CoV-2 infection. Relative to young hamsters, aged hamsters had a greater viral load during the acute phase of infection and displayed higher levels of sequelae during the post-acute phase. Early treatment with ABT-263 lowered pulmonary viral load in aged (but not young) animals, an effect associated with lower expression of ACE2, the receptor for SARS-CoV-2. ABT-263 treatment also led to lower pulmonary and systemic levels of senescence-associated secretory phenotype factors and to amelioration of early and late lung disease. These data demonstrate the causative role of age-associated pre-existing senescent cells on COVID-19 severity and have clear clinical relevance.

Senolytic therapy alleviates physiological human brain aging and COVID-19 neuropathology

“…as indicated. No statistical methods were used to predetermine sample size, but our sample sizes are similar to those reported in previous publications 19 , 43 . Data distribution was assumed to be normal, but this was not formally tested.…”

“…Given the positive survival and improved clinical performance outcomes induced by senolytic treatment, a phenomenon partially explained by reduction in lung senescence (Extended Data Fig. 6c ) and pathology as previously shown 19 , 43 , we investigated whether the oral administration of senolytics would impact the histological architecture and proinflammatory makeup of brains from infected mice. To this end we first tested the impact of senolytics on brain viral RNA levels.…”

Depletion of preexisting B‐cell lymphoma 2‐expressing senescent cells before vaccination impacts antigen‐specific antitumor immune responses in old mice

“…Quantitative RT‐PCR was performed exactly as described in (Delval et al, 2023 ). The murine primers used were as follows: p16 (5′‐GCTCTGGCTTTCGTGAACATGT‐3′, 5′‐TTGAGCAGAAGAGCTGCTACGT‐3′ and ( bcl2 ) (5′‐TCATGTGTGTGGAGAGCGTCA‐3′, 5′‐GATCCAGGTGTGCAGATGCC‐3′) and ( Gapdh ) (5′‐GCAAAGTGGAGATTGTTGCC‐3′, 5′‐ GCCTTGACTGTGCCGTTGA‐3′).…”

Activation of senescence in critically ill patients: mechanisms, consequences and therapeutic opportunities

“…This approach has shown beneficial results in models of lung fibrosis [ 72 ]. Recently, it has been shown that navitoclax decreases viral load, systemic inflammation and SASP markers in a model of COVID-19 in aged hamsters, in line with its senolytic activity [ 73 ]. Other pathways can be blocked using kinase inhibitors.…”