Repeated evolution of herbicide resistance inLolium multiflorumrevealed by haplotype-resolved analysis of acetyl-CoA carboxylase

Abstract

Herbicide resistance in weeds is one of the greatest challenges in modern food production. The grass species Lolium multiflorum is an excellent model species to investigate convergent evolution under similar selection pressure because populations have repeatedly evolved resistance to many herbicides, utilizing a multitude of mechanisms to neutralize herbicide damage. In this work, we investigated the gene that encodes acetyl-CoA carboxylase (ACCase), the target-site of the most successful herbicide group available for grass weed control. We sampled L. multiflorum populations from agricultural fields with history of intense herbicide use, and studied their response to three ACCase-inhibiting herbicides under controlled conditions. To elucidate the mechanisms of herbicide resistance and the genetic relationship among sampled populations, we resolved the haplotypes of 97 resistant and susceptible individuals by performing an amplicon-seq analysis using long-read DNA sequencing technologies, focusing on the DNA sequence encoding the carboxyl-transferase domain of ACCase. Our dose-response data indicated the existence of many, often unpredictable, resistance patterns to ACCase-inhibiting herbicides, where populations exhibited as much as 37-fold reduction in herbicide response. The majority of the populations exhibited resistance to all three herbicides studied. Phylogenetic and molecular genetic analyses revealed multiple evolutionary origins of resistance-endowing ACCase haplotypes, as well as widespread admixture in the region regardless of cropping system. The amplicons generated were very diverse, with haplotypes exhibiting 26 to 110 polymorphisms. Polymorphisms included insertions and deletions 1-31 bp in length, none of which were associated with the resistance phenotype. We also found evidence that some populations have multiple mechanisms of resistance. Our results highlight the astounding genetic diversity in L. multiflorum populations, and the potential for convergent evolution of herbicide resistance across the landscape that challenges weed management and jeopardizes sustainable weed control practices. We provide an in-depth discussion of the evolutionary and practical implications of our results.

Evolution of ACCase‐inhibitor resistance in Chloris virgata is conferred by a Trp2027Cys mutation in the herbicide target site

“…DNA and RNA extractions were carried out to quantify if copy number variation and alteration in the expression of ACCase were involved in ACCase inhibitor resistance in C. virgata . We extracted gene sequences from the draft genome using a local Blast search with the ACCase sequence from Lolium multiflorum 32 . We evaluated several primer pairs and chose them based on their efficiency and specificity with primer efficiency and melt curves, respectively.…”

“…We extracted gene sequences from the draft genome using a local Blast search with the ACCase sequence from Lolium multiflorum. 32 We evaluated several primer pairs and chose them based on their efficiency and specificity with primer efficiency and melt curves, respectively. Primers for ACCase (forward 5 0 TTCTTGGGCGGGAAGTGTAC; and reverse 5 0 AGGTCCACCTATGTTTGCCG) and GAPDH (forward 5 0 CCCAGCCCTTAACGGAAAGT; and reverse 5 0 GGTAGCAG ACTTCTCGAGCC) were designed to amplify short fragments (up to < 150 bp) of each gene.…”