Requirement of activating transcription factor 5 for murine fetal liver erythropoiesis

Zhang, Shuping; Chen, Jane-Jane

doi:10.1111/bjh.16202

Cited by 7 publications

(5 citation statements)

References 13 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…As a transcription factor, ATF5 targets the mitochondria through its amino-terminal mitochondrial-targeting sequence in the absence of mitochondrial stress. However, during mitochondrial dysfunction, ATF5 cannot be imported into the mitochondria and is transported to the nucleus instead via its nuclear localization signal, inducing the transcription of genes that affect mitochondrial apoptosis inhibition, anti-apoptotic mechanisms, cell growth, and migration [58][59][60][61][62][63]. In addition, ATF5 has been shown to be a critical regulator of cell proliferation and survival [64][65][66].…”

Section: Discussionmentioning

confidence: 99%

TMEM11 regulates cardiomyocyte proliferation and cardiac repair via METTL1-mediated m7G methylation of ATF5 mRNA

Chen,

Li,

et al. 2023

Cell Death Differ

View full text Add to dashboard Cite

The mitochondrial transmembrane (TMEM) protein family has several essential physiological functions. However, its roles in cardiomyocyte proliferation and cardiac regeneration remain unclear. Here, we detected that TMEM11 inhibits cardiomyocyte proliferation and cardiac regeneration in vitro. TMEM11 deletion enhanced cardiomyocyte proliferation and restored heart function after myocardial injury. In contrast, TMEM11-overexpression inhibited neonatal cardiomyocyte proliferation and regeneration in mouse hearts. TMEM11 directly interacted with METTL1 and enhanced m7G methylation of Atf5 mRNA, thereby increasing ATF5 expression. A TMEM11-dependent increase in ATF5 promoted the transcription of Inca1, an inhibitor of cyclin-dependent kinase interacting with cyclin A1, which suppressed cardiomyocyte proliferation. Hence, our findings revealed that TMEM11-mediated m7G methylation is involved in the regulation of cardiomyocyte proliferation, and targeting the TMEM11-METTL1-ATF5-INCA1 axis may serve as a novel therapeutic strategy for promoting cardiac repair and regeneration.

show abstract

Section: Discussionmentioning

confidence: 99%

TMEM11 regulates cardiomyocyte proliferation and cardiac repair via METTL1-mediated m7G methylation of ATF5 mRNA

Chen,

Li,

et al. 2023

Cell Death Differ

View full text Add to dashboard Cite

show abstract

“…The ΔΔC(t) method was used to quantify the fold change of the target genes. The primer sets used were: ATF4 (Forward, GCCGGTTTAAGTTGTGTGCT; Reverse, CTGGATTCGAGGAATGTGCT) (67), ATF5 (Forward, GGGTCATTTTAGCTCTGTGAGAGAA; Reverse, ATTTGTGCCCATAACCCCTAGA) (68), and RPS20 (Forward, AACAAGTCGGTCAGGAAGC; Reverse, TCCGCACAAACCTTCTCC).…”

Section: Methodsmentioning

confidence: 99%

Mitochondrial energy dysfunction induces remodeling of the cardiac mitochondrial protein acylome

Ghazal

et al. 2021

Preprint

View full text Add to dashboard Cite

Mitochondria are increasingly recognized as signaling organelles because, under conditions of stress, mitochondria can trigger various signaling pathways to coordinate the cell’s response. The specific pathway(s) engaged by mitochondria in response to defects in mitochondrial energy production in vivo and in high-energy tissues like the heart are not fully understood. Here, we investigated cardiac pathways activated in response to mitochondrial energy dysfunction by studying mice with cardiomyocyte-specific loss of the mitochondrial phosphate carrier (SLC25A3), an established model that develops cardiomyopathy as a result of defective mitochondrial ATP synthesis. In heart tissue from these mice, mitochondrial energy dysfunction induced a striking pattern of acylome remodeling, with significantly increased post-translational acetylation and malonylation. Mass spectrometry-based proteomics further revealed that energy dysfunction-induced remodeling of the acetylome and malonylome preferentially impacts mitochondrial proteins. Acetylation and malonylation modified a highly interconnected interactome of mitochondrial proteins, and both modifications were present on the enzyme isocitrate dehydrogenase 2 (IDH2). Intriguingly, IDH2 activity was enhanced in SLC25A3-deleted mitochondria, and further study of IDH2 sites targeted by both acetylation and malonylation revealed that these modifications can have site-specific and distinct functional effects. Finally, we uncovered a novel crosstalk between the two modifications, whereby mitochondrial energy dysfunction-induced acetylation of sirtuin 5 (SIRT5), inhibited its function. Because SIRT5 is a mitochondrial deacylase with demalonylase activity, this finding suggests that acetylation can modulate the malonylome. Together, our results position acylations as an arm of the mitochondrial response to energy dysfunction and suggest a mechanism by which focal disruption to the mitochondrial energy production machinery can have an expanded impact on global mitochondrial function.

show abstract

“…A recent study revealed that ATF5 is enriched in odontoblast-related nucleosome-free regions and promotes odontoblast terminal differentiation by increasing the enhancer activity of dentin matrix protein 1 (DMP1), which is mainly expressed in the odontoblast layer and important for bone development [36]. Another study demonstrated that the knockdown of ATF5 in murine erythroid progenitor cells significantly reduced the proliferation of fetal liver erythroid progenitors and inhibited erythroid differentiation [37].…”

Section: Cell Differentiation and Tissue Developmentmentioning

confidence: 99%

Advancements in Activating Transcription Factor 5 Function in Regulating Cell Stress and Survival

Paerhati

Liu

Jin

et al. 2022

IJMS

View full text Add to dashboard Cite

Activating transcription factor 5 (ATF5) belongs to the activating transcription factor/cyclic adenosine monophosphate (cAMP) response element-binding protein family of basic region leucine zipper transcription factors. ATF5 plays an important role in cell stress regulation and is involved in cell differentiation and survival, as well as centrosome maintenance and development. Accumulating evidence demonstrates that ATF5 plays an oncogenic role in cancer by regulating gene expressions involved in tumorigenesis and tumor survival. Recent studies have indicated that ATF5 may also modify the gene expressions involved in other diseases. This review explores in detail the regulation of ATF5 expression and signaling pathways and elucidates the role of ATF5 in cancer biology. Furthermore, an overview of putative therapeutic strategies that can be used for restoring aberrant ATF5 activity in different cancer types is provided.

show abstract

Requirement of activating transcription factor 5 for murine fetal liver erythropoiesis

Cited by 7 publications

References 13 publications

TMEM11 regulates cardiomyocyte proliferation and cardiac repair via METTL1-mediated m7G methylation of ATF5 mRNA

TMEM11 regulates cardiomyocyte proliferation and cardiac repair via METTL1-mediated m7G methylation of ATF5 mRNA

Mitochondrial energy dysfunction induces remodeling of the cardiac mitochondrial protein acylome

Advancements in Activating Transcription Factor 5 Function in Regulating Cell Stress and Survival

Contact Info

Product

Resources

About