Requirement of HDAC6 for Transforming Growth Factor-β1-induced Epithelial-Mesenchymal Transition

Abstract

The aberrant expression of transforming growth factor (TGF)-␤1 in the tumor microenvironment and fibrotic lesions plays a critical role in tumor progression and tissue fibrosis by inducing epithelial-mesenchymal transition (EMT). EMT promotes tumor cell motility and invasiveness. How EMT affects motility and invasion is not well understood. Here we report that HDAC6 is a novel modulator of TGF-␤1-induced EMT. HDAC6 is a microtubule-associated deacetylase that predominantly deacetylates nonhistone proteins, including ␣-tubulin, and regulates cell motility. We showed that TGF-␤1-induced EMT is accompanied by HDAC6-dependent deacetylation of ␣-tubulin. Importantly, inhibition of HDAC6 by small interfering RNA or the small molecule inhibitor tubacin attenuated the TGF-␤1-induced EMT markers, such as the aberrant expression of epithelial and mesenchymal peptides, as well as the formation of stress fibers. Reduced expression of HDAC6 also impaired the activation of SMAD3 in response to TGF-␤1. Conversely, inhibition of SMAD3 activation substantially impaired HDAC6-dependent deacetylation of ␣-tubulin as well as the expression of EMT markers. These findings reveal a novel function of HDAC6 in EMT by intercepting the TGF-␤-SMAD3 signaling cascade. Our results identify HDAC6 as a critical regulator of EMT and a potential therapeutic target against pathological EMT, a key event for tumor progression and fibrogenesis. Epithelial-mesenchymal transition (EMT)2 is defined as a series of events through which epithelial cells lose many of their epithelial characteristics and acquire properties that are typical of mesenchymal cells (1). Aberrant EMT has been well documented in chronic fibrosis in multiple organs and carcinoma progression. During progression to metastatic competence, carcinoma cells acquire mesenchymal gene expression patterns and properties through EMT, which results in coordinated alterations in adhesive properties, activation of proteolysis and motility, and competence to metastasize and establish secondary tumors at distant sites (1). Fibrosis is characterized by an increased number of myofibroblasts that deposit interstitial extracellular matrix. Mounting evidence indicates that a significant fraction of these myofibroblasts arise from the resident epithelial cells via EMT during renal and lung fibrogenesis (2-6).Family members of transforming growth factor (TGF)-␤ are among the most potent inducers of EMT in a variety of physiological and pathological contexts (7). The aberrant expression of TGF-␤1 is well documented in the tumor microenvironment and fibrotic lesions where TGF-␤1 is widely believed to promote tumor progression and tissue fibrosis (7). Several recent studies have elegantly demonstrated EMT of lung alveolar epithelial cells in biopsies from patients with idiopathic pulmonary fibrosis and in experimental pulmonary fibrosis (4,5,8). A host of evidence indicates an essential role for SMAD3 in the expression of a panel of EMT-related genes upon translocation into the nucleus (9). The molecular me...

Protein Acetylation in the Cardiorenal Axis

“…Class I HDACs appear to play a key role in repression of the E-cadherin gene promoter as components of a repression complex containing the SMAD3 transcription factor and the Snail and ZEB corepressors (Figure 4). 72 However, RNA interference studies have also suggested that HDAC6, through its ability to deacetylate tubulin and promote SMAD3 nuclear import, is linked to EMT in lung epithelial cells, 73 leaving the roles of specific HDAC isoforms in promoting EMT in question. Future studies using highly selective iso-HDACis as pharmacological tools should be greatly helpful in this regard.…”

Modulation of lung inflammation by the Epstein-Barr virus protein Zta

“…Lavage cell pellets were defrosted on ice, and mRNA was extracted as above for C10 cell pellets with the exception that 350 l of RLT lysis buffer was used for total RNA extraction and 250 ng of total RNA was used for first-strand synthesis as described above. The quantity and quality of each individual cDNA sample was validated by qPCR using primers for 36B4 (74) and 18S using the following primer pair (18s-reverse 5=GTCGGGAGTGGGTAATTTGC3=; 18S-forward 5=GAGGGAGCCTGAGAAACGG3=). Transcript expression levels were then determined in Adv-Zta-and Adv-GFP-treated BAL cells by combining equal cDNA amounts and performing real-time quantitative PCR using the mouse Th-17 for autoimmunity and inflammation RT 2 profiler PCR array platform (SA Bioscience).…”

The Epstein-Barr Virus Latent Membrane Protein 1 and Transforming Growth Factor–β1 Synergistically Induce Epithelial–Mesenchymal Transition in Lung Epithelial Cells

“…A549 and HPL1D cells were cultured as previously described (24,25). During treatment with recombinant human TGF-b1 (R&D Systems, Minneapolis, MN), A549 cells were cultured in Dulbecco's modified Eagle's medium plus 0.5% FBS.…”

“…The LMP1 adenovirus (28) was provided by S. Gottschalk (Baylor University School of Medicine, Houston, TX). RT 2 -PCR primers were purchased from Integrated DNA Technologies (36B4, E-Cad, PAI-1, MMP9, vimentin, collagen 1 [25], Fn, alpha smooth muscle actin (aSMA) [29], Snai1, Slug, and ZEB-1 [30]; Coralville, Iowa) or SA Bioscience (Smad 7, SP-C; Frederick, MD).…”