Rescue of coagulation factor VII function by the U1+5A snRNA

Abstract

Our previous studies with genomic minigenes have demonstrated that an engineered small nuclear RNA-U1 (U1؉5a) partially rescued coagulation factor VII (FVII) mRNA processing impaired by the 9726؉5G>A mutation. Here, to evaluate the U1؉5a effects on FVII function, we devised a full-length FVII splicingcompetent construct (pSCFVII-wt). This construct drove in COS-1 cells the synthesis of properly processed FVII transcripts and of secreted functional FVII (23 ؎ 4 ng/ mL), which were virtually undetectable upon introduction of the 9726؉5G>A mutation (pSCFVII-9726؉5a). Cotransfection of pSCFVII-9726؉5a with pU1؉5a resulted in a partial rescue of FVII splicing and protein biosynthesis. The level increase in medium was dose dependent and, with a molar excess (1.5؋) of pU1؉5a, reached 9.5% plus or minus 3.2% (5.0 ؎ 2.8 ng/mL) of FVII-wt coagulant activity. These data provide the first insights into the U1-snRNA-mediated rescue of donor splice sites at protein level, thus further highlighting its therapeutic implications in bleeding disorders, which would benefit even from tiny increase of functional levels. (Blood. 2009;113: 6461-6464) IntroductionThe elucidation of molecular mechanisms underlying aberrant mRNA processing, a frequent cause of all inherited human disorders, 1-2 has provided the rationale for RNA-based correction strategies that offer several advantages over the gene replacement therapy methods, including maintenance of the proper transcriptional control of the disease gene.The vast majority of RNA-based approaches have exploited, in vitro and in vivo, antisense sequences to either mask natural splice sites, to induce skipping of defective exons, 3-5 or newly generated cryptic sites, 3,[6][7][8] to favor the use of the canonical ones. Only a few attempts [9][10][11][12] have been made to restore gene expression impaired by mutations at canonical donor splice sites (5'ss), which are the most frequent targets in human disease genes, 1 including coagulation factor genes. 13-18 Although we 10-12 and others 9 have partially restored correct splicing using the small nuclear RNA U1 (U1-snRNA), 19 the experimental settings did not allow the assessment of rescue at protein and function levels, the key issue for the evaluation of the therapeutic potential.Here, by exploiting a splicing-competent full-length construct, and thus a novel cellular model of severe coagulation factor VII (FVII) deficiency caused by the IVS7 9726ϩ5GϾA mutation, 20 we demonstrated that the U1-snRNA-mediated rescue of FVII mRNA processing eventually results in an appreciable secretion of functional FVII. Methods Creation of vectorsExpression vectors for the secreted human FVII 21 and for the parental (pU1-wt) and mutated (pU1ϩ5a) human U1-snRNA 11 were available in the laboratory.To create the full-length splicing-competent constructs, the FVII gene region spanning exons 6 through 8 (nt's 8926-11157) 22 from our previously prepared wild-type and mutated minigene constructs 11 was amplified with primers 5Ј GCATCTTTCTGACTTTTGTT 3Ј (forward) a...

An Exon-Specific U1snRNA Induces a Robust Factor IX Activity in Mice Expressing Multiple Human FIX Splicing Mutants

“…Differently, our and other groups extensively exploited the physiological role of the U1snRNA to promote exon inclusion in the presence of exon-skipping mutations, 5,6,7,8,9,10,11,12,13,14,15,16,17 a relevant cause of severe forms of human genetic disease. 18,19,20 The first generation of engineered U1snRNA had a modified 5′ tail with increased complementarity to defective 5′ss, and were shown to rescue exon inclusion in several cellular 5,6,7,8,9,10,11,12,13,14,15,16,21 and also in vivo 17 disease models.…”

“…18,19,20 The first generation of engineered U1snRNA had a modified 5′ tail with increased complementarity to defective 5′ss, and were shown to rescue exon inclusion in several cellular 5,6,7,8,9,10,11,12,13,14,15,16,21 and also in vivo 17 disease models. However, these U1snRNAs are often tailored on the disease-causing mutation and have the intrinsic risk of off-target effects by recognizing the partially conserved donor splice site 22 in other splicing units.…”

Agammaglobulinemia: causative mutations and their implications for novel therapies

“…Review www.expert-reviews.com coagulation factor transcripts and the secretion of factors VII and IX in cell culture [66,67]. The other approach is to enhance the binding of endogenous spliceosome components through the use of bifunctional oligonucleotides (BONs).…”

Transposon-mediated Generation of Cellular and Mouse Models of Splicing Mutations to Assess the Efficacy of snRNA-based Therapeutics

“…5,6 In the recent years, modified U1snRNAs have been exploited to correct splicing mutations causing severe coagulation factor VII deficiency and Hemophilia B (HB) using cellular or animal models expressing episomal minigenes. 7,8,9,10,11 In fact, the thorough evaluation of U1snRNA-mediated correction strategies in vivo requires the use of mouse models, which are not always available. Here, we exploited the hyperactive Sleeping Beauty transposon system (SB100X) 12,13 as a tool to quickly and efficiently develop cellular and mouse models for the c.519A>C splicing mutation (here indicated as hFIXex5-2C) in the F9 gene, previously reported in patients affected by HB 14 .…”