research paper: Role of the cold shock domain protein A in the transcriptional regulation of HBG expression

Abstract

Summary Impaired switching from fetal haemoglobin (HbF) to adult globin gene expression leads to hereditary persistence of fetal haemoglobin (HPFH) in adult life. This is of prime interest because elevated HbF levels ameliorate β‐thalassaemia and sickle cell anaemia. Fetal haemoglobin levels are regulated by complex mechanisms involving factors linked or not to the β‐globin gene (HBB) locus. To search for factors putatively involved in the expression of the γ‐globin genes (HBG1, HBG2), we examined the reticulocyte transcriptome of three siblings who had different HbF levels and different degrees of β‐thalassaemia severity although they had the same ΗBA‐ and ΗΒB cluster genotypes. By mRNA differential display we isolated the cDNA coding for the cold shock domain protein A (CSDA), also known as dbpA, previously reported to interact in vitro with the HBG2 promoter. Expression studies performed in K562 and in primary erythroid cells showed an inverse relationship between HBG and CSDA expression levels. Functional studies performed by Chromatin Immunoprecipitation and reporter gene assays in K562 cells demonstrated that CSDA is able to bind the HBG2 promoter and suppress its expression. Therefore, our study demonstrated that CSDA is a trans‐acting repressor factor of HBG expression and modulates the HPFH phenotype.

Environmental Oxygen Tension Regulates the Energy Metabolism and Self-Renewal of Human Embryonic Stem Cells

“…ChIP experiments were performed with HIF-2α (Novus Biologicals) or immunoglobulin G (IgG) antibody (Santa Cruz) as previously described [20], [21] except that immuno-complexes were washed using high-salt buffers as followed: 10 times with 600 µl buffer A (0.1% SDS, 2 mM EDTA, 20 mM Tris HCl pH8, 1% Triton X-100, 500 mM NaCl), 8 times with 600 µl buffer B (0.1% SDS, 2 mM EDTA, 20 mM Tris HCl pH8, 1% Triton X-100, 1 M NaCl), 3 times with 600 µl TE (10 mM Tris HCl H8, 1 mM EDTA) buffer. Recovered DNA was amplified with custom Taqman Assays (Applied Biosystems) spanning a predicted hypoxia response element (HRE) site at −1691 bp of the GLUT1 proximal promoter (GLUT1 fwd: CAAATGTGTGGATGTGAGTTGC; GLUT1 rev: CCATCACGGTCCTTCTTCATG; GLUT1 probe: AGGCTGAGCGTGTAAA).…”

Transcriptional Repressors of Fetal Globin Genes as Novel Therapeutic Targets in Beta-Thalassemia

“…In fact, down-and up-modulation of CSDA levels consistently corresponded to variations of HBG expression levels: CSDA knockdown induced by RNAi resulted in significantly increased expression of HBG genes, whereas its overexpression was associated with reduced HBG mRNA levels. Also, chromatin immunoprecipitation (ChiP) analysis in K562 cells showed that CSDA interacts with this promoter region, thus confirming that CSDA modulates HBG expression at the transcriptional level [18]. Subsequently, it has been proposed that NF-kB and histone deacethylase 2 (HDAC2) interact with CSDA to form a multiprotein complex which take part to the regulation of HBG2 expression by modulating local chromatin conformation [23], thus highlighting the relevance of the role played by CSDA in fetal globin gene expression and shedding novel light on the molecular mechanisms involved in globin gene switching (Figure 3).…”

“…CSDA acts as a repressor of many cellular genes including the human granulocytemacrophage colony-stimulating factor (GM-CSF), an important hematopoietic growth factor [17]. More recently, it has been demonstrated that CSDA acts as a repressor of fetal globin gene expression by binding a region −200 bp upstream of the HBG2 gene [18] (Figure 2). This region consists of alternating homopurine and homopyrimidine tracts generating an H-DNA structure [19].…”

“…Previous studies had suggested that disruption of the intramolecular triplex could abolish CSDA binding sites conditions in this HBG2 promoter region [19,21,22], thus leading to persistent expression of fetal hemoglobin in adult life [19]. Based on RNA interference (RNAi) and overexpression studies in human erythroleukemia K562 cells and in primary erythroid cells, CSDA was demonstrated to directly play a repression role in HBG expression [18]. In fact, down-and up-modulation of CSDA levels consistently corresponded to variations of HBG expression levels: CSDA knockdown induced by RNAi resulted in significantly increased expression of HBG genes, whereas its overexpression was associated with reduced HBG mRNA levels.…”

Molecular Basis of Thalassemia

“…It had been found that the BCL11A locus codifies for a transfactor acting as repressor of fetal globin genes (Xu et al, 2011). Recently, another repressor of fetal globin genes, the Cold Shock Domain Protein A or CSDA, has been identified and characterized (Petruzzelli et al, 2010). Therefore, both these two factors may be directly involved in the switching of globin gene expression through silencing of the transcriptional activity of globin genes in adult life, although additional studies are required in order to define better their role in the regulation of this complex mechanism of gene expression.…”