Restricted distribution and limited gene flow in the model ciliate <i><scp>T</scp>etrahymena thermophila</i>

Zufall, Rebecca A.; Dimond, Kristen L.; Doerder, F. Paul

doi:10.1111/mec.12066

Cited by 46 publications

(65 citation statements)

References 65 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…DNA from Cerophyll or PPY grown cells was purified with a modified microwave procedure [28] as previously described [29]. The cox 1 (mitochondrial cytochrome oxidase I) barcode region was amplified in standard PCR with primers cox 1ATf (ATGTGAGTTGATTTTATAGA) and 689r (CTCTTCTATGTCTTAAACCAGGCA), purified with shrimp alkaline phosphatase and exonuclease III, and sequenced in both directions with the same primers.…”

Section: Methodsmentioning

confidence: 99%

Abandoning sex: multiple origins of asexuality in the ciliate Tetrahymena

Doerder

2014

BMC Evol Biol

View full text Add to dashboard Cite

BackgroundBy segregating somatic and germinal functions into large, compound macronuclei and small diploid micronuclei, respectively, ciliates can explore sexuality in ways other eukaryotes cannot. Sex, for instance, is not for reproduction but for nuclear replacement in the two cells temporarily joined in conjugation. With equal contributions from both conjugants, there is no cost of sex which theory predicts should favor asexuality. Yet ciliate asexuality is rare. The exceptional Tetrahymena has abandoned sex through loss of the micronucleus; its amicronucleates are abundant in nature where they reproduce by binary fission but never form conjugating pairs. A possible reason for their abundance is that the Tetrahymena macronucleus does not accumulate mutations as proposed by Muller’s ratchet. As such, Tetrahymena amicronucleates have the potential to be very old. This study used cytochrome oxidase-1 barcodes to determine the phylogenetic origin and relative age of amicronucleates isolated from nature.ResultsAmicronucleates constituted 25% of Tetrahymena-like wild isolates. Of the 244 amicronucleates examined for cox1 barcodes, 237 belonged to Tetrahymena, seven to other genera. Sixty percent originated from 12 named species or barcoded strains, including the model Tetrahymena thermophila, while the remaining 40% represent 19 putative new species, eight of which have micronucleate counterparts and 11 of which are known only as amicronucleates. In some instances, cox1 haplotypes were shared among micronucleate and amicronucleates collected from the same source. Phylogenetic analysis showed that most amicronucleates belong to the “borealis” clade in which mating type is determined by gene rearrangement. Some amicronucleate species were clustered on the SSU phylogenetic tree and had longer branch lengths, indicating more ancient origin.ConclusionsNaturally occurring Tetrahymena amicronucleates have multiple origins, arising from numerous species. Likely many more new species remain to be discovered. Shared haplotypes indicate that some are of contemporary origin, while phylogeny indicates that others may be millions of years old. The apparent success of amicronucleate Tetrahymena may be because macronuclear assortment and recombination allow them to avoid Muller’s ratchet, incorporate beneficial mutations, and evolve independently of sex. The inability of amicronucleates to mate may be the result of error(s) in mating type gene rearrangement.

show abstract

Section: Methodsmentioning

confidence: 99%

Abandoning sex: multiple origins of asexuality in the ciliate Tetrahymena

Doerder

2014

BMC Evol Biol

View full text Add to dashboard Cite

show abstract

“…These are phenomena commonly seen at the family and genus levels; however, at the species level, many cases were cosmopolitanism has been assumed have been disproven by molecular data [5]. While some empirical studies have supported the Bass-Becking hypothesis in some species of microorganisms [6], [12]–[15], there are many examples, not only for the majority of fungi [2], [16]–[21], but also for other microbial eukaryotes, marine and fresh water invertebrates, and even for some protists [22]–[27], where this hypothesis has been disproven. Since the rise of molecular phylogenetics over two decades ago, the view that microorganisms have large-scale spatial distributional ranges has changed, mostly due to the use of molecular markers and phylogenetic analyses, which have increased the level of resolution in systematics studies [2].…”

Section: Introductionmentioning

confidence: 99%

Not as Ubiquitous as We Thought: Taxonomic Crypsis, Hidden Diversity and Cryptic Speciation in the Cosmopolitan Fungus Thelonectria discophora (Nectriaceae, Hypocreales, Ascomycota)

2013

View full text Add to dashboard Cite

The distribution of microbial species, including fungi, has long been considered cosmopolitan. Recently, this perception has been challenged by molecular studies in historical biogeography, phylogeny and population genetics. Here we explore this issue using the fungal morphological species Thelonectria discophora, one of the most common species of fungi in the family Nectriaceae, encountered in almost all geographic regions and considered as a cosmopolitan taxon. In order to determine if T. discophora is a single cosmopolitan species or an assemblage of sibling species, we conducted various phylogenetic analyses, including standard gene concatenation, Bayesian concordance methods, and coalescent-based species tree reconstruction on isolates collected from a wide geographic range. Results show that diversity among isolates referred as T. discophora is greatly underestimated and that it represents a species complex. Within this complex, sixteen distinct highly supported lineages were recovered, each of which has a restricted geographic distribution and ecology. The taxonomic status of isolates regarded as T. discophora is reconsidered, and the assumed cosmopolitan distribution of this species is rejected. We discuss how assumptions about geographically widespread species have implications regarding their taxonomy, true diversity, biological diversity conservation, and ecological functions.

show abstract

“…Moreover, it has been shown that detailed sampling of particular species can reveal previously hidden molecular variability. This happened recently both in the model algae species of the genus Klebsormidium, where 66% of rbcL genotypes from nearctic and palaearctic colonies were identified for the first time (Ryšánek et al 2015), and in the ciliate Tetrahymena thermophila, which is restricted to east coast of the USA (Zufall et al 2012). Similarly, in five Paramecium species (7 populations from the Qingdao neighborhood) as many as 90 COI haplotypes were recently identified (Zhao et al 2013).…”

Section: The Reasons For the Wide Distribution Of Paramecium Biaureliamentioning

confidence: 95%

“…In summary, a high adaptive capacity for new environmental conditions (Gill and Hairston 1972) as well as a vast population size (Finlay 2002) may be key factors for the wide distribution of P. biaurelia. In contrast, small population size causes restricted gene flow and restricted distribution in the other flagship ciliate-Tetrahymena thermophila (Zufall et al 2012). …”

Section: The Reasons For the Wide Distribution Of Paramecium Biaureliamentioning

confidence: 99%

“…Until now two DNA regions have most frequently been used in P. aurelia studies: ribosomal (ITS1-5.8S-ITS2-5'LSU rDNA), and mitochondrial (a part of COI gene) regions . Moreover these regions have been proposed as a DNA barcoding tool for other ciliates (Strüder-Kypke and Lynn 2010; Stoeck et al 2014b), and have been used as a markers for population studies in particular ciliates (Gentekaki and Lynn 2009;Zufall et al 2012) as well as in several Paramecium species (Snoke et al 2006;Zhao et al 2013).…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Worldwide sampling reveals low genetic variability in populations of the freshwater ciliate Paramecium biaurelia (P. aurelia species complex, Ciliophora, Protozoa)

2018

View full text Add to dashboard Cite

Species (or cryptic species) identification in microbial eukaryotes often requires a combined morphological and molecular approach, and if possible, mating reaction tests that confirm, for example, that distant populations are in fact one species. We used P. biaurelia (one of the 15 cryptic species of the P. aurelia complex) collected worldwide from 92 sampling points over 62 years and analyzed with the three above mentioned approaches as a model for testing protistan biogeography hypotheses. Our results indicated that despite the large distance between them, most of the studied populations of P. biaurelia do not differ from each other (rDNA fragment), or differ only slightly (COI mtDNA fragment). These results could suggest that in the past, the predecessors of the present P. biaurelia population experienced a bottleneck event, and that its current distribution is the result of recent dispersal by natural or anthropogenic factors. Another possible explanation for the low level of genetic diversity despite the huge distances between the collecting sites could be a slow rate of mutation of the studied DNA fragments, as has been found in some other species of the P. aurelia complex. COI haplotypes determined from samples obtained during field research conducted in 2015-2016 in 28 locations/374 sampling points in southern Poland were shared with other, often distant P. biaurelia populations. In the Kraków area, we found 5 of the 11 currently known COI P. biaurelia haplotypes. In 5 of 7 reservoirs from which P. biaurelia was obtained, two different COI haplotypes were identified.

show abstract

Restricted distribution and limited gene flow in the model ciliate Tetrahymena thermophila

Cited by 46 publications

References 65 publications

Abandoning sex: multiple origins of asexuality in the ciliate Tetrahymena

Abandoning sex: multiple origins of asexuality in the ciliate Tetrahymena

Not as Ubiquitous as We Thought: Taxonomic Crypsis, Hidden Diversity and Cryptic Speciation in the Cosmopolitan Fungus Thelonectria discophora (Nectriaceae, Hypocreales, Ascomycota)

Worldwide sampling reveals low genetic variability in populations of the freshwater ciliate Paramecium biaurelia (P. aurelia species complex, Ciliophora, Protozoa)

Contact Info

Product

Resources

About