RETRACTED ARTICLE: Knockdown of astrocyte-elevated gene-1 inhibits prostate cancer progression through upregulation of FOXO3a activity

Kikuno, Nobuyuki; Shiina, Hìroaki; Urakami, Shinji; Kawamoto, Ken; Hirata, Hiroshi; Tanaka, Yuichiro; Place, Robert F.; Pookot, Deepa; Majid, Shahana; Igawa, Mikio; Dahiya, Rajvir

doi:10.1038/sj.onc.1210572

Cited by 194 publications

(162 citation statements)

References 28 publications

Supporting

Mentioning

153

Contrasting

Order By: Relevance

“…The results showed that transcription factors able to bind directly to the eIF4E promoter included NFκB, C/EBPα and β, AP‐1, SP‐1, RXRβ and Oct‐1. Previous studies showed that by activating PI3K/Akt signalling, AEG‐1 activated the transcription factors FoxO1, FoxO3a, NFκB and AP‐1 32, 51, 52. Moreover, AEG‐1 directly interacted with p65‐NFκB, SND1 and PLZF to regulate gene transcription 50, 53, 54.…”

Section: Discussionmentioning

confidence: 99%

“…Quantitative PCR was conducted using FastStart Universal SYBR Green PCR Master mix (4913914001) (Rox; 11929100) from Roche (Indianapolis, IN, USA), according to the manufacturer's instructions. The forward (F) and reverse (R) primers were synthesized by Invitrogen as follows: AEG‐1, F: 5′‐ACGACCTGGCCTTGCTGAAGAATCT‐3′ and R: 5′‐CGGTTGTAAGTTGCTCGGTGGTAA‐3′; eIF4E, F: 5′‐CCTACAGAACAGATGGGCACTC‐3′ and R: 5′‐GCCCAAAAGTCTTCAACAGTATCA‐3′; GAPDH, F, 5′‐ATGGGGAAGGTGAAGGTCG‐3′ and R, 5′‐GGGGTCATTGATGGCAACAATA‐3′ 32, 33. All measurements were performed in triplicate and measured with the ABI Prism 7300 sequence detection system (Applied Biosystems, Foster City, CA, USA), as previously described.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

AEG‐1 induces gastric cancer metastasis by upregulation of eIF4E expression

Yang

et al. 2017

J Cellular Molecular Medi

View full text Add to dashboard Cite

Gastric cancer is the third leading cause of cancer‐related deaths worldwide, and patients with lymph node, peritoneal and distant metastasis have a poor prognosis. Overexpression of Astrocyte‐elevated gene‐1 (AEG‐1) has been reported to be correlated with the progression and metastasis of gastric cancer. However, its mechanisms are quite unclear. In this study, we found that elevated expression of AEG‐1 was correlated with metastasis in human gastric cancer tissues. Moreover, gain‐ or loss‐of‐function of AEG‐1, respectively, promoted or suppressed epithelial–mesenchymal transition (EMT), migration and invasion of gastric cancer cells. AEG‐1 positively regulated eIF4E, MMP‐9 and Twist expression. Manipulating eIF4E expression by transfection of overexpression constructs or siRNAs partially eliminated AEG‐1‐regulated EMT, cell migration and invasion. In addition, overexpression or knockdown of eIF4E promoted or suppressed EMT, cell migration and invasion in parallel with upregulation of MMP‐9 and Twist expression, while manipulating eIF4E expression partially abrogated AEG‐1‐induced MMP‐9 and Twist. Finally, silencing of AEG‐1 expression not only inhibited tumour growth in parallel with downregulation of eIF4E, MMP‐9 and Twist expression in a xenograft nude mouse model, but also suppressed lymph node and peritoneal metastasis of gastric cancer in an orthotopic nude mouse model. These findings suggest that AEG‐1 promotes gastric cancer metastasis through upregulation of eIF4E‐mediated MMP‐9 and Twist, which provides new diagnostic markers and therapeutic targets for cancer metastasis.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

AEG‐1 induces gastric cancer metastasis by upregulation of eIF4E expression

Yang

et al. 2017

J Cellular Molecular Medi

View full text Add to dashboard Cite

show abstract

“…Despite the abundance of MTDH phenotypes, a consensus understanding of its underlying molecular mechanisms has not yet been reached. MTDH has been shown to influence several oncogenic signaling pathways and transcription factors, such as Ha-Ras (15), PI3K/AKT (13), ERK, Wnt/␤-catenin (8), NF-B (16), c-Myc (15), and FOXO1/FOXO3a (17,18). However, MTDH regulation of signaling pathways appears to be context-dependent with affected pathways varying by tumor type and cell line (19,20).…”

mentioning

confidence: 99%

Identification of Staphylococcal Nuclease Domain-containing 1 (SND1) as a Metadherin-interacting Protein with Metastasis-promoting Functions

Blanco

Alečković

Hua

et al. 2011

Journal of Biological Chemistry

100

114

View full text Add to dashboard Cite

Metastasis is the deadliest and most poorly understood feature of malignant diseases. Recent work has shown that Metadherin (MTDH) is overexpressed in over 40% of breast cancer patients and promotes metastasis and chemoresistance in experimental models of breast cancer progression. Here we applied mass spectrometry-based screen to identify staphylococcal nuclease domain-containing 1 (SND1) as a candidate MTDH-interacting protein. After confirming the interaction between SND1 and MTDH, we tested the role of SND1 in breast cancer and found that it strongly promotes lung metastasis. SND1 was further shown to promote resistance to apoptosis and to regulate the expression of genes associated with metastasis and chemoresistance. Analyses of breast cancer clinical microarray data indicated that high expression of SND1 in primary tumors is strongly associated with reduced metastasis-free survival in multiple large scale data sets. Thus, we have uncovered SND1 as a novel MTDH-interacting protein and shown that it is a functionally and clinically significant mediator of metastasis.Metastasis is responsible for the majority of cancer-related deaths (1). An increasing number of genes have been implicated in mediating different steps of metastasis, but relatively few are mechanistically well characterized (2). One recently verified mediator of distant metastasis is Metadherin (MTDH 3 ; also called Lyric and AEG1 (3-5)). MTDH has been shown to be a key functional target of the 8q22 genomic gain that is frequently observed in poor prognosis breast cancer patients (6). Beyond promoting experimental lung metastasis (3, 6), multiple studies have implicated MTDH as a mediator of several cancer-related processes, such as oncogenesis and angiogenesis (7,8), invasion (9), chemoresistance (6, 10 -12), apoptosis resistance (13), and autophagy (14). Despite the abundance of MTDH phenotypes, a consensus understanding of its underlying molecular mechanisms has not yet been reached. MTDH has been shown to influence several oncogenic signaling pathways and transcription factors, such as Ha-Ras (15), PI3K/AKT (13), ERK, Wnt/␤-catenin (8), NF-B (16), c-Myc (15), and FOXO1/FOXO3a (17, 18). However, MTDH regulation of signaling pathways appears to be context-dependent with affected pathways varying by tumor type and cell line (19,20). Furthermore, prior work on MTDH molecular mechanisms has largely focused on hypothesis-driven investigations into the ability of MTDH to influence classical oncogenic pathways with little exploration to date on protein-level interactions (16,21).In this study, we aimed to expand the knowledge of MTDH molecular functionality and also uncover novel genes involved in promoting distant metastasis. Our approach utilized an unbiased, mass spectrometry-based screen for MTDH-interacting partners. We identified and characterized the interaction between MTDH and one such protein, SND1. SND1 is a multifunctional protein with reported roles in transcriptional activation (22), RNA editing (23, 24), formation of the RNAinduced ...

show abstract

“…Overexpression of AEG-1 also augmented the anchorage-independent growth of HeLa cells and human glioma cell lines and increased their migration and invasion properties (14,15). Conversely, inhibition of AEG-1 by siRNA significantly inhibited migration and invasion of malignant glioma cells and prostate cancer cells and in vivo lung metastasis of breast cancer cells (16)(17)(18)(19). In PHFA, FM516-SV, and cloned rat embryo fibroblasts (CREF), AEG-1 protects from serum starvation-induced apoptosis by activating the PI3K/Akt signaling pathway indicating, but not definitively proving, that AEG-1 might function as an oncogene (20).…”

mentioning

confidence: 99%