RNA polymerase II CTD S2P is dispensable for embryogenesis but mediates exit from developmental diapause in C. elegans

Abstract

Serine 2 phosphorylation (S2P) within the CTD of RNA polymerase II is considered a Cdk9/Cdk12-dependent mark required for 3′-end processing. However, the relevance of CTD S2P in metazoan development is unknown. We show that cdk-12 lesions or a full-length CTD S2A substitution results in an identical phenotype in Caenorhabditis elegans. Embryogenesis occurs in the complete absence of S2P, but the hatched larvae arrest development, mimicking the diapause induced when hatching occurs in the absence of food. Genome-wide analyses indicate that when CTD S2P is inhibited, only a subset of growth-related genes is not properly expressed. These genes correspond to SL2 trans-spliced mRNAs located in position 2 and over within operons. We show that CDK-12 is required for maximal occupancy of cleavage stimulatory factor necessary for SL2 trans-splicing. We propose that CTD S2P functions as a gene-specific signaling mark ensuring the nutritional control of the C. elegans developmental program.

Transcription-wide mapping of dihydrouridine reveals that mRNA dihydrouridylation is required for meiotic chromosome segregation

“…Gene deletions resulted in [ATG-STOP] replacement and gene tagging resulted in a C-terminal tagging by removal of the endogenous STOP codon and insertion of the TAP (tandem affinity purification tag) sequence. Genome editing at the nda2 locus with CRISPR was performed using the ura4-based cloning-free method as described (Zhang et al, 2018) with the following guide TACCGATTTTGAAACCAGTA(nGG) and repair template: GGCTGCCGT TACTAGCATTAAATCTCGTCGCACCATCCAATTTGCCGATTGGTGtCCTACTGGTTTCAAAATCGGTATTTGCTATGAGCC with the underlined sequence highlighting the mutated codon (GTT -> GCC) and the lowercase ''t'' indicated the mutated PAM (Cassart et al, 2020).…”

Quantitative analysis of C. elegans transcripts by Nanopore direct-cDNA sequencing reveals terminal hairpins in non trans-spliced mRNAs

“…Our analysis revealed additional complexity in the C. elegans dual trans-splicing system. The majority of SL2 trans-splicing is predominantly targeted to genes located in close downstream proximity to another one, supporting a mechanistic link between mRNA 3' end formation and the downstream addition of SL2 for resolving multicistronic primary transcripts 26,27 . Our data however indicate that there is a significant number of SL2 genes that are derived from isolated genes with their own promoter.…”

Characterization of factors that underlie transcriptional silencing in C. elegans oocytes

“…The goal of this study was to define the molecular components for genome silencing in C. elegans oocytes. To monitor transcription, we relied on RNAPIIpSer2 staining, as we and others have done extensively in the past [11,15,19,44,45]. One concern with this antibody-based approach is that chromatin compaction in -2 oocytes may prevent access of the antibody to its target on chromatin, rendering false-negative data.…”