Role of the Main Access Channel of Catalase-Peroxidase in Catalysis

Abstract

Catalase-peroxidases (KatG) are bifunctional heme peroxidases with an overwhelming catalatic activity. The structures show that the buried heme b is connected to the exterior of the enzyme by a main channel built up by KatG-specific loops named large loop LL1 and LL2, the former containing the highly conserved sequence Met-Gly-Leu-Ile-Tyr-Val-Asn-Pro-Glu-Gly. LL1 residues Ile248, Asn251, Pro252, and Glu253 of KatG from Synechocystis are the focus of this study because of their exposure to the solute matrix of the access channel. In particular, the I248F, N251L, P252A, E253Q, and E253D mutants have been analyzed by UV-visible and resonance Raman spectroscopies in combination with steady-state and presteady-state kinetic analyses. Exchange of these residues did not alter the kinetics of cyanide binding or the overall peroxidase activity. Moreover, the kinetics of compound I formation and reduction by one-electron donors was similar in the variants and the wild-type enzyme. However, the turnover numbers of the catalase activity of I248F, N251L, E253Q, and E253D were only 12.3, 32.6, 25, and 42% of the wild-type activity, respectively. These findings demonstrate that the oxidation reaction of hydrogen peroxide (not its reduction) was affected by these mutations. The altered kinetics allowed us to monitor the spectral features of the dominating redox intermediate of E253Q in the catalase cycle. Resonance Raman data and structural analysis demonstrated the existence of a very rigid and ordered structure built up by the interactions of these residues with distal side and also (via LL1) proximal side amino acids, with the heme itself, and with the solute matrix in the channel. The role of Glu253 and the other investigated channel residues in maintaining an ordered matrix of oriented water dipoles, which guides hydrogen peroxide to its site of oxidation, is discussed.

An Oxyferrous Heme/Protein-based Radical Intermediate Is Catalytically Competent in the Catalase Reaction of Mycobacterium tuberculosis Catalase-Peroxidase (KatG)

“…The optical spectrum of the pH 8.5 samples does not resemble that assigned to the ferric peroxo form of horseradish peroxidase or heme oxygenase (39,40), whereas the EPR data are clearly consistent with a low spin ferric peroxy heme; the intermediate formed at pH 8.5 at room temperature had been confirmed elsewhere to be a ferric species because in the presence of cyanide, a typical six coordinate low spin ferric complex was directly formed from it (41). A complete understanding of the identity of all species under these conditions awaits further study.…”

Hydrogen peroxide oxidation by catalase‐peroxidase follows a non‐scrambling mechanism

“…Another important residue at the distal heme cavity is D152, which is part of the substrate channel and has its side chain carboxyl group pointing toward the heme pocket. It participates in maintaining a rigid and extended hydrogen-bond network, which is important for the H 2 O 2 oxidation reaction [18,24]. Variants that had these residues exchanged (D152S, W122F, Y249F, and R439A) showed a significantly reduced catalase (see Table 1) but a normal or even enhanced peroxidase activity [9].…”

Radical Sites in Mycobacterium tuberculosis KatG Identified Using Electron Paramagnetic Resonance Spectroscopy, the Three-dimensional Crystal Structure, and Electron Transfer Couplings

“…The oligonucleotide pairs (mutated codons are in bold) were: W107F, 303 CGTTCCACGCTGCCGGCACC 336 -3Ј and 5Ј-336 GGTGCC-GGCAGCGTGGAACGCCATCCGGATAAAC 303 -3Ј; W91F, 256 CCTCGCAGCCGTGGTTTCCCGCCGACTACG 286 -3Ј and 5Ј-286 CGTAGTCGGCGGGAAACCACGGCTGCG-AGG 256 -3Ј; Y229F, 672 GATGGGGCTGATCTTCGTGAA-CCCGGAGG 700 -3Ј and 5Ј-700 CCTCCGGGTTCACGAAG-ATCAGCCCCATC 672 -3Ј. 4 S. Yu and R. Magliozzo, unpublished data. (26)) and displayed using PyMOL software.…”

“…The detailed reasons for this are in some cases related to a change in the stability of intermediates in either mechanism in mutants; for example, in Mtb KatG[Y229F], a very rapid conversion of compound I, the classical oxoferryl heme -cation radical species, to a stable compound II occurs, allowing peroxidase activity but eliminating catalase activity (8); and in Mtb KatG[W107F], facile conversion to and stable formation of compound III also interferes with catalase activity. 4 Amino acid-based radicals play roles in those mechanistic changes. The formation of the covalent bonds within the distal side adduct is also proposed to involve Tyr and Trp radicals (14).…”