Role of tyrosine 238 in the active site of Rhodotorula gracilisd‐amino acid oxidase

Abstract

Y238, one of the very few conserved residues in the active site of D-amino acid oxidases (DAAO), was mutated to phenylalanine and serine in the enzyme from the yeast Rhodotorula gracilis. The mutated proteins are catalytically competent thus eliminating Tyr238 as an active-site acid/ base catalyst. Y238F and Y238S mutants exhibit a threefold slower turnover on D-alanine as substrate, which can be attributed to a slower rate of product release relative to the wild-type enzyme (a change of the rate constants for substrate binding was also evident). The Y238 DAAO mutants have spectral properties similar to those of the wild-type enzyme but the degree of stabilization of the flavin semiquinone and the redox properties in the free form of Y238S are different. The binding of the carboxylic acid competitive inhibitors and the substrate D-alanine are changed only slightly, suggesting that the overall substrate binding pocket remains intact. In agreement with data from the pH dependence of ligand binding and with the protein crystal structure, site-directed mutagenesis results emphasize the importance of residue Y238 in controlling access to the active site instead of a role in the substrate/ligand interaction.Keywords: active site lid; function-structure relationships; flavoprotein; reaction mechanism; substrate recognition. D-amino acid oxidase (DAAO; EC 1.4.3.3), an FADcontaining flavoprotein, catalyses dehydrogenation of the D-isomer of amino acids to give the corresponding a-imino acids and, after subsequent hydrolysis, a-keto acids and ammonia. The reduced FAD is then reoxidized by molecular oxygen to yield hydrogen peroxide. The DAAO reaction has many biotechnological applications. Industrially its main use is to remove the side chain of cephalosporin c to give 7-aminocephalosporanic acid, a key intermediate for the production of semisynthetic cephalosporin antibiotics [1]. A fundamental question remains within the large class of flavoprotein oxidases that catalyse the oxidation of amino or a-hydroxy acids regarding the mechanism by which a proton and two electrons are transferred from the substrate a-carbon to the flavin N(5) position during the reductive half-reaction. The precise mechanism of substrate dehydrogenation by DAAO is widely debated, even if the crystal structures of the enzyme purified from pig kidney (pkDAAO) and of the enzyme from Rhodotorula gracilis (RgDAAO) (at a resolution of 2.6 Å and 1.2 Å , respectively) have been determined [2][3][4]. Over the years, three main but different mechanisms have been proposed for the reaction catalysed by this flavoenzyme (reviewed in [5]): (a) a direct hydride-transfer mechanism of a-hydrogen of the substrate to the N(5) position of the flavin [6]; (b) a concerted mechanism in which the a-proton abstraction is coupled with the transfer of a hydride from the amino group of the substrate [7]; and (c) a carbanion mechanism which involves the initial formation of a carbanion by subtracting the a-H of the substrate as a proton [8]. Thus, to deprotonate the a-proton...

On the mechanism of Rhodotorula gracilis d-amino acid oxidase: role of the active site serine 335

“…pT7-S335G plasmid was used to transform BL21(DE3)pLysS E. coli cells and the highest level of S335G mutant expression and specific activity in crude extracts (2.5 U/mg protein) was obtained by inducing cells with 1.0 mM IPTG in the exponential growth phase (OD 600 c0.8) and cultivation overnight at 30 8C. Fifty milligrams of pure enzyme was isolated from 10 l of culture, a value close to that obtained for other RgDAAO mutants [4][5][6].…”

“…[11]. The RgDAAO S335G mutant was generated by sitedirected mutagenesis using the Altered Sitesk II Kit [5,6] and the GCGTATGGCTTCTCCGGTGCGGGATACCAGC primer. The mutation eliminated a XhoI restriction site (italics); the codon for the substitution is underlined.…”

“…Dissociation constants for ligands were estimated spectrophotometrically by adding small volumes (1-10 Al) of concentrated stock solutions to samples containing 1 ml of c10 AM enzyme, at 15 8C [4]. The reaction of RgDAAO with d-or l-lactate was performed using an anaerobic cuvette under strict anaerobic conditions even in the presence of glucose and glucose oxidase (see below) [1,6,8].…”

“…The role of the active site tyrosines and arginine has been elucidated by studying the properties of corresponding mutants [4][5][6]. Specifically, none of these residues plays a role in the chemistry of catalysis, e.g., as H + -abstracting bases.…”

“…In the free form of RgDAAO (i.e., in the absence of a ligand), R285 might have a role in the stabilization of anionic semiquinone and fully reduced flavin forms since it could rotate to within 3 2 from the pyrimidine flavin moiety [5]. In addition, the Y238 side chain is assumed to act as a lid-controlling substrate/product exchange at the active site of RgDAAO [6,7].…”