Roles of kisspeptin in IVF/ICSI-treated infertile women and in human granulosa cells

Abstract

Kisspeptin, a crucial central regulator of reproduction, has been used as a trigger in in vitro fertilization (IVF) treatment. This study aimed to investigate the roles of kisspeptin in IVF treatment in infertile females ( n = 30); and in steroidogenesis in human granulosa-like tumor cell line (KGN). In the human study, blood was collected at three time points including (1) the beginning of gonadotropin stimulation (Phase I), (2) around eight days after gonadotropin stimulation (Phase II), and (3) on the day of ovum pick-up (Phase III). Follicular fluid (FF) was collected at Phase III. Serum human chorionic gonadotropin (hCG) was measured 15 days after embryo transfer and fetal heart beats were determined around 42 days of menstrual cycle to classify the subjects into successful and unsuccessful groups. FF kisspeptin levels were higher in successful compared with unsuccessful subjects ( P < 0.01). Kisspeptin levels were significantly higher in FF than in serum in successful subjects ( P < 0.05) but were comparable in unsuccessful subjects. Serum kisspeptin was comparable among three phases in the successful group but its levels in Phase III were significantly lower compared with Phase I in the unsuccessful group ( P < 0.01). Serum kisspeptin in Phase II/III had positive correlations with serum E2 in Phases II and III and the outcomes of IVF/intracytoplasmic sperm injection (ICSI) treatment including serum hCG levels. For the cell experiment ( n = 3), kisspeptin treatment in the presence of FSH together with IGF-1 enhanced CYP19A1 (aromatase) mRNA expression compared with control. FSH alone increased aromatase concentrations in the supernatant compared with control and kisspeptin at the dose of 10-2 mmol/L with FSH enhanced aromatase concentrations in the supernatant compared with FSH alone ( P < 0.001 all). In conclusion, kisspeptin enhanced aromatase expression and secretion and was associated with positive outcomes of IVF/ICSI treatment. Further studies regarding supplementation of kisspeptin could reveal its beneficial effects on IVF/ICSI treatment.

Kisspeptin System and Menarcheal Age as Predictors of Primary Female Infertility: A Case-Control Study Among Nigerian Women

“…However, early menopause is a potential driver for primary infertility through decrease in plasma Kisspeptin and increase in KISS1 gene expression in the blood. This finding justifies the Kisspeptin or KISS1R agonist supplementation in women already showing promise [35,[67][68][69][70][71][72][73] , which could also be helpful for PIW with history of early menarche. KISS1 gene expression in the blood is central to the role of the Kisspeptin system and may be a significant regulator of its effect within the human blood;…”

“…The findings of this present study add to the justification for Kisspeptin supplementation for GnRH stimulation and suggest that supplementation may be needed by PIW who present with a history of early menarche. Kisspeptin supplementation has been used in clinical trials as KP-10 and KP-54 isoforms in females with hypothalamic amenorrhoea [67][68][69] , PCOS [35] , or infertile women requiring IVF, with a need to prevent OHSS or stimulate ovulation [70][71][72][73] . The trials mentioned above have shown no noticeable side effects across various doses, times, and routes of administration.…”

A Longitudinal Study of the Relationship of Adiponectin with Reproduction in Infertile Women Undergoing IVF/ICSI Treatment, and an Experimental Study in Human Granulosa Cells

“…For humans, information regarding age, body weight, BMI, the duration of the menstrual cycle, the duration of ovarian stimulation, serum FSH, and serum LH in the three phases of the IVF/ICSI treatment were presented as the 25th percentile, median, and 75th percentile. The mean values of these parameters and the differences between successful and unsuccessful pregnancies were reported in a previously published paper [19]. Other data are shown as the mean ± standard deviation (SD).…”

“…In accordance with the manufacturer's instructions, the cDNA was amplified as follows: 5 min at 25 • C, 30 min at 42 • C, and 5 min at 85 • C using the MasterCycler gradient (Eppendorf, Hamburg, Germany), which then was kept at −20 • C until RT-PCR analysis. The primer sequences of the FSHR, CYP19A1, and HPRT1 genes were designed by the authors and published previously [19] as follows: FSHR (240 base pairs): forward-5 AGGAATGC-CATTGAACTGAGGT 3 , reverse-5 CAGATATTGAAGGTTGGGAAGGT 3 ; CYP19A1 (267 base pairs): forward-5 AGCAAGTCCTCAAGTATGTTCCAC 3 , reverse-5 GTC-CACATAGCCCGATTCATT 3 ; and HPRT1 (156 base pairs): forward-5 CCTGGCGTCGT-GATTAGTGA 3 , reverse-5 CCATCTCCTTCACATCTCG 3 .…”