Rolling circle amplification: A high fidelity and efficient alternative to plasmid preparation for the rescue of infectious clones

Marano, Jeffrey; Chuong, Christina; Weger-Lucarelli, James

doi:10.1016/j.virol.2020.08.016

Cited by 13 publications

(15 citation statements)

References 25 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The assembled product was amplified by RCA with the FemtoPhi DNA amplification kit (Evomic Science). Virus rescue was performed by transfecting RCA products directly into BHK-21 cells using JetOptimus (Polyplus), as we have previously described [65]. Viral titers were measured by plaque assay.…”

Section: Methodsmentioning

confidence: 99%

“…(5’ AAGGTGCTTAGGGAGCTACT 3’). A standard curve was generated using full-length MAYV genomic RNA derived from a SP6-containing MAYV infectious clone [65] to calculate MAYV genomes per milliliter of supernatant, and the genome:PFU ratio was calculated by dividing the genome concentration by the PFUs per milliliter of supernatant achieved via plaque assay.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

The E2 glycoprotein holds key residues for Mayaro virus adaptation to the urban Aedes aegypti mosquito

Roesch

Cereghino

Carrau

et al. 2022

Preprint

Self Cite

View full text Add to dashboard Cite

Adaptation to mosquito vectors suited for transmission in urban settings is a major driver in the emergence of arboviruses. To better anticipate future emergence events, it is crucial to assess their potential to adapt to new vector hosts. In this work, we used two different experimental evolution approaches to study the adaptation process of an emerging alphavirus, Mayaro virus (MAYV), to Aedes aegypti, an urban mosquito vector of many arboviruses. We identified E2-T179N as a key mutation increasing MAYV replication in insect cells and enhancing transmission by live Aedes aegypti. In contrast, this mutation decreased viral replication and binding in human fibroblasts, a primary cellular target of MAYV in humans. We also showed that MAYV E2-T179N was attenuated in vivo in a mouse model. We then used structural and experimental analyses to show that MAYV E2-T179N bound less efficiently to human cells, though the decrease in replication or binding was not mediated through interaction with one of the host receptors, Mxra8. When this mutation was introduced in the closely related chikungunya virus, which has caused major outbreaks globally in the past two decades, we observed increased replication in both human and insect cells, suggesting E2 position 179 is an important determinant of alphavirus host-adaptation, although in a virus-specific manner. Collectively, these results indicate that adaptation at the T179 residue in MAYV E2 may result in increased vector competence – but coming at the cost of optimal replication in humans – and may represent a first step towards a future emergence event.Author SummaryMosquito-borne viruses must replicate in both mosquito and vertebrate hosts to be maintained in nature successfully. When viruses that are typically transmitted by forest dwelling mosquitoes enter urban environments due to deforestation or travel, they must adapt to urban mosquito vectors to transmit effectively. For mosquito-borne viruses, the need to also replicate in a vertebrate host like humans constrains this adaptation process. Towards understanding how the emerging alphavirus, Mayaro virus, might adapt to transmission by the urban mosquito vector, Aedes aegypti, we used natural evolution approaches to identify several viral mutations that impacted replication in both mosquito and vertebrate hosts. We show that a single mutation in the receptor binding protein increased transmission by Aedes aegypti but simultaneously reduced replication and disease in a mouse model, suggesting that this mutation alone is unlikely to be maintained in a natural transmission cycle between mosquitoes and humans. Understanding the adaptive potential of emerging viruses is critical to preventing future pandemics.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

The E2 glycoprotein holds key residues for Mayaro virus adaptation to the urban Aedes aegypti mosquito

Roesch

Cereghino

Carrau

et al. 2022

Preprint

Self Cite

View full text Add to dashboard Cite

show abstract

“…The infectious cDNA clone allows researchers to explore many different aspects of virology, including viral kinetics [2,3], evolution [4,5], tropism [6-8], and vaccinology [9][10][11][12]. The traditional approach to produce infectious clones involves generating fragments from viral RNA by RT-PCR and then cloning these fragments into bacterial plasmids [13]. However, traditional cloning approaches can be di cult due to viral genomic instability in living hosts, which often arises when the genomes of aviviruses [14], alphaviruses [15], and coronaviruses [16] are introduced into bacteria.…”

Section: Introductionmentioning

confidence: 99%

“…Having previously demonstrated the ability to rescue and manipulate infectious clones using rolling circle ampli cation (RCA), an in vitro process [2,13,50,51], we set out to use an emerging technology called replication-cycle reaction (RCR) [52][53][54][55] to develop a pipeline to produce novel infectious clones. The RCR system works by reconstituting 14 proteins and 25 polypeptides critical for chromosomal replication in E.coli bacteria [52].…”

Section: Introductionmentioning

confidence: 99%

An in vitro workflow to create and modify novel infectious clones using replication cycle reaction

Marano

Cereghino

Finkielstein

et al. 2022

Preprint

Self Cite

View full text Add to dashboard Cite

Reverse genetics systems are a critical tool in combating emerging viruses by enabling a better understanding of the genetic mechanisms by which they cause disease. Traditional cloning approaches are fraught with difficulties due to the bacterial toxicity of many viral sequences. Many attempts have been made to develop a simplified workflow to produce a simple-to-use infectious clone without the concerns of host toxicity; however, none offers the advantages of bacterial cloning without the various disadvantages. This paper demonstrates a novel in vitro workflow that leverages gene synthesis and replication cycle reaction—an innovative technology that reconstitutes the bacterial replication machinery in a tube—to develop a supercoiled infectious clone plasmid that is easy to rescue. Using this workflow, we developed two infectious clones, one of a low passage dengue virus serotype 2 isolate (PUO-218) and the Washington strain of SARS-CoV-2, which behaved similarly to their respective parental viruses. Furthermore, we generated a medically relevant mutant of SARS-CoV-2, Spike D614G. These results indicate that this novel in vitro workflow is a viable method to generate and manipulate infectious clones, specifically for viruses that are notoriously difficult for traditional bacterial-based cloning methods. This work represents a paradigm shift in producing infectious clones and lowers the barrier of entry for scientists to develop such tools.

show abstract

“…Techniques for analyzing nucleic acids in samples are widely used for quantitative and qualitative detection of pathogens in clinical laboratories (Riley, 2018;Kellner et al, 2019;Pumford et al, 2020;Corman et al, 2020;Paul et al, 2020). Nucleic acid amplification is typically carried out with polymerase chain reaction (PCR) and various isothermal amplification methods (Waggoner et al, 2016), such as recombinase polymerase amplification (RPA) (Lobato and O'Sullivan, 2018), recombinase aided amplification (RAA) (Qi et al, 2019), rolling-circle amplification (RCA) (Marano et al, 2020), loop-mediated isothermal amplification (LAMP) (Zhu et al, 2020) and helicase dependent amplification (HDA) (Liu et al, 2020). PCR has the advantages of simple primers and probe design and real time fluorescence quantitative detection, however it is time-consuming and needs to be improved in the sensitivity.…”

Section: Introductionmentioning

confidence: 99%

RAP: A Novel Approach to the Rapid and Highly Sensitive Detection of Respiratory Viruses

Fan

Zhang

et al. 2021

Front. Bioeng. Biotechnol.

View full text Add to dashboard Cite

Recombinase aided amplification (RAA) is an emerging isothermal amplification method used for detecting various pathogens. However, RAA requires a complex and long probe to ensure high sensitivity during fluorescence assay. TaqMan probe used for quantitative PCR (qPCR) is simple and universal. Herein, we developed a new approach for detecting nucleic acids of pathogens, known as RAP (Recombinase aided PCR). The method combines RAA and qPCR to ensure a rapid and highly sensitive detection using a conventional qPCR device. RAP is a two-stage amplification process performed in a single tube within 1 hour. The method involves an RAA reaction for 10 min at 39°C (first stage) followed by 15 cycles of qPCR (second stage). Using human adenovirus 3 (HADV3) and human adenovirus 7 (HADV7) plasmids, the sensitivities of RAP assays for detecting HADV3 and HADV7 were 6 and 17 copies per reaction, respectively. The limit of RAP detection was at least 16-fold lower than the corresponding qPCR, and no-cross reaction with other respiratory viruses was observed. The results of RAP analysis revealed 100% consistency with qPCR assay. This study shows that RAP assay is a rapid, specific, and highly sensitive detection method with a potential for clinical and laboratory application.

show abstract

Rolling circle amplification: A high fidelity and efficient alternative to plasmid preparation for the rescue of infectious clones

Cited by 13 publications

References 25 publications

The E2 glycoprotein holds key residues for Mayaro virus adaptation to the urban Aedes aegypti mosquito

The E2 glycoprotein holds key residues for Mayaro virus adaptation to the urban Aedes aegypti mosquito

An in vitro workflow to create and modify novel infectious clones using replication cycle reaction

RAP: A Novel Approach to the Rapid and Highly Sensitive Detection of Respiratory Viruses

Contact Info

Product

Resources

About