Root Rot Resistance Locus PaLAR3 Is Delivered by Somatic Embryogenesis (SE) Pipeline in Norway Spruce (Picea abies (L.) Karst.)

Abstract

Research Highlights: The Norway spruce somatic embryogenesis (SE) pipeline is suitable for multiplication of material with root rot resistance traits. Background and Objectives: Heterobasidion root rot is the economically most severe forest pathogen in Europe, reducing the benefit of planting elite forest material. In this study, the SE-propagation ability of elite Norway spruce material carrying root rot resistance traits was studied. Materials and Methods: We analyzed the presence of the root rot resistance locus PaLAR3B among 80 Finnish progeny-tested Norway spruce plus-trees used for SE-plant production as well as in 241 SE lines (genotypes) derived from them. Seven full-sib families with lines having either AA, AB, or BB genotype for PaLAR3 locus were further studied for their SE-plant propagation ability. Results: The results indicate that 43.8% of the studied elite trees carry the PaLAR3B allele (41.3% are heterozygous and 2.5% homozygous). The resistance allele was present among the SE lines as expected based on Mendelian segregation and did not interfere with somatic embryo production capacity. All embryos from PaLAR3 genotypes germinated well and emblings were viable in the end of first growing season. However, in three families, PaLAR3B homo- or heterozygotes had 23.2% to 32.1% lower viability compared to their respective hetero- or PaLAR3A homozygotes. Conclusions: There is no trade-off between root rot resistance locus PaLAR3B and somatic embryo production ability, but the allele may interfere with Norway spruce embling establishment.

Micropropagation, Characterization, and Conservation of Phytophthora cinnamomi-Tolerant Holm Oak Mature Trees

“…Conventional breeding programs with forest species are time consuming, mainly because of the long lifespan of trees, and biotechnology can be a very valuable tool for generating disease-tolerant genotypes [18,47,48]. Propagation of tolerant genotypes (also called "escape" genotypes) detected by screening natural genetic variation has been suggested as a possible alternative to conventional methods, in order to produce tolerant genotypes in a relatively short time [49].…”

Allele PaLAR3B in root rot resistance locus does not influence the infection pressure by Heterobasidion parviporum through root contacts

“…DNA was extracted from 70 to 100 μg of needle material, with DNeasy Plant Pro Kit Plant (Qiagen) following the manufacturer's instructions. PCR was done as in Edesi et al (2021) with minor modifications. Briefly, the PCR protocol was as follows: 1X PCR Buffer, 200 μM dNTP, 0.5 μM primer 1 (LAR_ComA: 5'–GAAATCTGCAGCCAATGGA–3') (Edesi et al, 2021), 0.25 μM primer 2 (LAR_B2: 5'–CTGTATAACCGTAACATCTACTG–3') (Edesi et al, 2021), 0.25 μM primer 3 (LAR_A: 5'–GAACGGGTATAAACTCCGT–3') (Edesi et al, 2021), 0.2 U/μl DNA polymerase (DreamTaq DNA Polymerase, Thermo Scientific™), 5 μl of crude DNA as template; the reaction volume was adjusted to 12, 5 μl with autoclaved MQ H 2 O.…”

Drought Stress Described by Transcriptional Responses of Picea abies (L.) H. Karst. under Pathogen Heterobasidion parviporum Attack

“…Similarly, several markers are suggested for Heterobasidion annosum s.l. resistance [24,40,53,54]. These traits should all be studied for suitability in breeding programs as due to long tree generations, Norway spruce might not keep up with the changes in the local environment, making them more susceptible to infection by Heterobasidion species.…”