ROR-γ drives androgen receptor expression and represents a therapeutic target in castration-resistant prostate cancer

Abstract

The androgen receptor (AR) is overexpressed and hyperactivated in human castration-resistant prostate cancer (CRPC). However, the determinants of AR overexpression in CRPC are poorly defined. Here we show that retinoid acid receptor-related orphan receptor γ (ROR-γ) is overexpressed and amplified in metastatic CRPC tumors, and that ROR-γ drives AR expression in the tumors. ROR-γ recruits coactivators SRC-1 and -3 to an AR-RORE to stimulate AR gene transcription. ROR-γ antagonists suppress the expression of AR and its variant AR-V7 in prostate cancer (PCa) cell lines and tumors. ROR-γ antagonists also markedly diminish genome-wide AR binding, H3K27ac abundance and expression of the AR gene network. Lastly, ROR-γ antagonists suppressed tumor growth in multiple AR-expressing but not AR-negative xenograft PCa models, and effectively sensitized CRPC tumors to enzalutamide, without overt toxicity in mice. Together, these results establish ROR-γ as a key player in CRPC by acting upstream of AR and a potential therapeutic target for advanced PCa.

Galectin-3 Is Implicated in Tumor Progression and Resistance to Anti-androgen Drug Through Regulation of Androgen Receptor Signaling in Prostate Cancer

“…Therefore, investigation of the mechanism of CRPC is important. A number of potential mechanisms of CRPC have been reported, including: i) AR overexpression; ii) promiscuous binding and activation of mutant AR by alternative ligands, such as estrogen, progesterone, glucocorticoids, bicalutamide, and flutamide; iii) ligand-independent mechanisms of AR activation via crosstalk with serine/threonine kinase 1 (AKT), erb-b2 receptor tyrosine kinase 2 (HER2), and AKT serine/threonine kinase 1 (AKT1) kinases that phosphorylate the AR, and via long non-coding ANTICANCER RESEARCH 37: 125-134 (2017) 130 RNAs that bind to the AR to stimulate transcription of AR target genes; and iv) AR-independent pathways through signal transducer and activator of transcription 3 (STAT3) signaling or up-regulation of anti-apoptotic BCL2, apoptosis regulator (BCL2) (30)(31)(32)(33)(34). In the present study, we revealed that galectin-3 activated PSA transcription and enhanced expression of AR target genes such as KLK3 and TMPRSS2.…”

The emerging roles of orphan nuclear receptors in prostate cancer

“…One latest study reveals that AR expression is driven by the upregulation of RORγ in metastatic CRPC [144]. RORγ can controls AR gene expression through its direct binding to AR promoter via exonic ROR-binding element and association with steroid receptor coactivator members (SRCs).…”

“…RORγ can controls AR gene expression through its direct binding to AR promoter via exonic ROR-binding element and association with steroid receptor coactivator members (SRCs). RORγ-specific agonist can potently inhibit prostatic tumor growth and metastasis in vivo [144]. Androgen exercises opposite roles on TR2 and TR4: represses TR2 [14] and induces TR4 expression [145].…”

Silencing the epigenetic silencer KDM4A for TRAIL and DR5 simultaneous induction and antitumor therapy

“…Lentiviral particles were produced in 293T cells after co-transfection of the above lentivirus vectors, psPAX2 and pMD2.G in 10-cm dishes, as described. 55 siRNAs for gene knockdown were purchased from Dharmacon. The siRNA target sequences for KDM4A are as follows: KDM4A#1, GCUGCAGUAUUGAGAUGCUAA; KDM4A#2, GCCUUGGAUCUUUCUGUGAA; Control, CAGUCGCGUUUGCGACUGG.…”