S-nitrosylation influences the structure and DNA binding activity of AtMYB30 transcription factor from Arabidopsis thaliana

Abstract

MYB proteins are a family of transcription factors that play an important role in plant development and regulatory defense processes. Arabidopsis thaliana MYB30 (AtMYB30), a member of this protein family, is involved in cell death processes during the hypersensitive response (HR) of plants. HR is characterized by a vast production of reactive oxygen species (ROS) and nitric oxide (NO). NO may thus influence the binding of AtMYB30 to DNA. In this work we evaluated the effect of NO on AtMYB30 DNA binding activity, and also in the protein structural properties. A fully active minimal DNA-binding domain (DBD) of AtMYB30 (residues 11-116) containing two cysteine residues (C49 and C53) was overexpressed and purified. Site-directed mutagenesis was used to obtain AtMYB30 DBD mutants C49A and C53A. The DNA binding activity of AtMYB30 DBD, and Cys single mutants is clearly inhibited upon incubation with a NO donor, and S-nitrosylation was confirmed by the biotin switch assay. Finally, in order to understand the mechanism of NO effect on AtMYB30 DNA binding activity we performed circular dichroism analysis, to correlate the observed protein function inhibition and a potential structural impairment on AtMYB30 DBD. Indeed, NO modification of C49 and C53 residues promotes a subtle modification on the secondary structure of this transcription factor. We thus demonstrated, using various techniques, the in vitro effect of NO on AtMYB30 DBD, and thus the potential consequences of NO activity on plant metabolism influenced by this transcription factor.

Biochemical analysis of the interaction between Arabidopsis thaliana AtMYB30 transcription factor and its DNA specific target site

“…We should mention that C49 was suggested to be the most important site of nitrosylation in AtMYB30 (Tavares et al 2014), but as we describe here, the mutation of this cysteine residue to alanine causes no impact on DNA binding. Okashi et al (2005) evaluated the binding affinity of complexes between a DNA-binding domain of the transcription factor c-MYB and several double-stranded DNA by electrospray ionization mass spectrometry; K D values in the range of 6.3×10 −7 M to 2.8×10 −9 M, similar to those obtained by us (10 −9 M) were found.…”

“…We have previously shown (Tavares et al 2014) that AtMYB30 DBD and their single Cys-Ala mutants effectively bind to DNA, and this function is inhibited by S-nitrosylation as a result of the secondary structure alteration caused by NO binding. One hypothesis explaining the effect of NO on AtMYB30 activity points to the possibility of an interaction between two Cys residues (49 and 53) in the DBD of AtMYB30, in the form of a disulfide bond.…”

“…The data for this interaction indicates that the sequence 5′-AAACCAA in the 48 bp probe was protected from DNase I cleavage (Fig. 4); this sequence corresponds to the theoretical MYB binding site (Tavares et al 2014). This consensus sequence rich in A and C nitrogenous bases is certainly the region of DNA that binds to R2R3 fragment in AtMYB30 predicted to contain two consecutive HTH motifs (Gabrielsen et al 1991).…”

“…Electrophoretic mobility shift assay Electrophoretic mobility shift assay (EMSA) was performed as described in Tavares et al 2014, where the AtMYB30 DBD and Cys-Ala mutants used in the present work were also described. All binding reactions were performed with 125 nM double-stranded oligonucleotide labeled probe (5′-/ Alexa647N/ CTTTCTTTACCTACCACCAACCTAACGG TCAAACCAACCAAACCTCTG-3′) and increasing concentrations of wild type or mutant proteins (0-500 nM).…”

“…Spectra were collected in a JASCO J-815 spectropolarimeter equipped with a Peltier temperature control unit as described in Tavares et al 2014. For all the scans recorded, the baseline spectrum containing only the buffer or buffer plus DNA were subtracted.…”