S100.alpha., CAPL, and CACY: molecular cloning and expression analysis of three calcium-binding proteins from human heart

Engelkamp, Dieter; Bw, Schäfer; Erné, Paul; Cw, Heizmann

doi:10.1021/bi00157a012

Cited by 84 publications

(50 citation statements)

References 55 publications

(72 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…YACs 950 e 2#1 to #11 represent single colonies from the unstable CEPH YAC culture 950 e 2. Specific markers for S100A1, S100A2, S100A8, S100A9, S100A10, S100A11, S100A13, SPRR1B, SPRR2A, SPRR3, LOR, IVL, FLG, THH, CHRNB2, D1S305, D1S1664, D1S2346, D1S3619, D1S3623, D1S3624, D1S3625, D1S3626, D1S3627, D1S3628, 37m2, 37m6, and 37m16 were the same as described previously (Engelkamp et al 1992;Volz et al 1993;Pedrocchi et al 1994;Hudson et al 1995;Mischke et al 1996;Wicki et al 1996a,b;Lueders et al 1999;South et al 1999). Cloned cDNA inserts or fragments of them used as probes that were isolated from the gridded library are listed in Table 5.…”

Section: Yacs and Dna Probesmentioning

confidence: 99%

Identification of Human Epidermal Differentiation Complex (EDC)-Encoded Genes by Subtractive Hybridization of Entire YACs to a Gridded Keratinocyte cDNA Library

Marenholz¹,

Zirra²,

Fischer³

et al. 2001

Genome Res.

104

View full text Add to dashboard Cite

The epidermal differentiation complex (EDC) comprises a large number of genes that are of crucial importance for the maturation of the human epidermis. So far, 27 genes of 3 related families encoding structural as well as regulatory proteins have been mapped within a 2-Mb region on chromosome 1q21. Here we report on the identification of 10 additional EDC genes by a powerful subtractive hybridization method using entire YACs (950 e 2 and 986 e 10) to screen a gridded human keratinocyte cDNA library. Localization of the detected cDNA clones has been established on a long-range restriction map covering more than 5 Mb of this genomic region. The genes encode cytoskeletal tropomyosin TM30nm (TPM3), HS1-binding protein Hax-1 (HAX1), RNA-specific adenosine deaminase (ADAR1), the 34/67-kD laminin receptor (LAMRL6), and the 26S proteasome subunit p31 (PSMD8L), as well as five hitherto uncharacterized proteins (NICE-1, NICE-2, NICE-3, NICE-4, and NICE-5). The nucleotide sequences and putative ORFs of the EDC genes identified here revealed no homology with any of the established EDC gene families. Whereas database searches revealed that NICE-3, NICE-4, and NICE-5 were expressed in many tissues, no EST or gene-specific sequence was found for NICE-2. Expression of NICE-1 was up-regulated in differentiated keratinocytes, pointing to its relevance for the terminal differentiation of the epidermis. The newly identified EDC genes are likely to provide further insights into epidermal differentiation and they are potential candidates to be involved in skin diseases and carcinogenesis that are associated with this region of chromosome 1. Moreover, the extended integrated map of the EDC, including the polymorphic sequence tag site (STS) markers D1S1664, D1S2346, and D1S305, will serve as a valuable tool for linkage analyses.

show abstract

Section: Yacs and Dna Probesmentioning

confidence: 99%

Identification of Human Epidermal Differentiation Complex (EDC)-Encoded Genes by Subtractive Hybridization of Entire YACs to a Gridded Keratinocyte cDNA Library

Marenholz¹,

Zirra²,

Fischer³

et al. 2001

Genome Res.

104

View full text Add to dashboard Cite

show abstract

“…For reverse transcript polymerase chain reaction (RT ± PCR), cDNA was synthesized using SuperScript RT, RNase H 7 reverse transcriptase (Gibco BRL), according to the manufacturer's instructions, from 1 mg of total RNA which had been annealed with oligo (dT) 17 . S100A4 sequences were ampli®ed from one twentieth of the reverse transcription reaction by PCR using the primers: p9H5': CAGATCCTGACTGCTGC-CATGGCG and p9H3': ACGTGTCTGAAGGAGC-CATGGTGG, which ampli®ed a 420 bp region of human S100A4 mRNA (Engelkamp et al, 1992) and primers p9R5': TTCCACAAATACTCAGGCAAC and p9R3': CACCCACAATCTCCAGTCTCTC which ampli®ed a 418 bp region of the rat S100A4 (p9Ka) mRNA. The conditions of PCR used for both sets of primers were: 948C for 60 s to denature DNA prior to thermal cycling at 948C for 60 s, 558C for 30 s and 728C for 60 s for 20 cycles.…”

Section: Dna Hybridizationmentioning

confidence: 99%

Human S100A4 (p9Ka) induces the metastatic phenotype upon benign tumour cells

et al. 1998

View full text Add to dashboard Cite

The rodent S100-related calcium-binding protein, S100A4 induces metastasis in non-metastatic rat and mouse benign mammary cells and co-operates with benign-tumour-inducing changes in two transgenic mouse models, to yield metastatic mammary tumours. Cotransfection of the human gene for S100A4 with pSV2neo into the benign rat mammary cell line, Rama 37, yielded cells which expressed a low level of the endogenous S100A4 mRNA, and either high or undetectable levels of human S100A4 mRNA. The cells which expressed a high level of human S100A4 mRNA induced metastasis in the benign rat mammary cell line Rama 37 in an in vivo assay, whereas the cells which expressed an undetectable level of human S100A4 did not induce any detectable metastases. The primary tumours arising from the S100A4-expressing cells contained high levels of immunocytochemically-detected S100A4 and this high level of S100A4 and the metastatic potential were maintained when cells from a metastasis were re-injected into syngeneic rats. The results show that the human S100A4 possesses metastasis-inducing capabilities.

show abstract

“…Addition of the muscle calcium-binding proteins calmodulin, S100A1 2 . CACY or CAPL 24 did not increase kinase activity significantly (Fig. 7a).…”

Section: Activation Of Titin Kinasementioning

confidence: 84%

“…The MIRAS map was further improved by cycles of solvent¯attening with program DM 24 . Using these and F o 2 F c and 2F o 2 F c maps, interspersed with positional and individual B-factor re®nement using X-PLOR 26 , the model was rebuilt, side chains were added, and the Exd loops and N-terminal arms were built with the program O (ref.…”

mentioning

confidence: 99%

See 1 more Smart Citation

Erratum: Genomic-sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori

Alm¹,

Ling²,

Moir³

et al. 1999

Nature

View full text Add to dashboard Cite

Ubx-homeodomain electron density, and polyalanine helices were placed into the Exd-homeodomain density. The MIRAS map was further improved by cycles of solvent¯attening with program DM 24 . Using these and F o 2 F c and 2F o 2 F c maps, interspersed with positional and individual B-factor re®nement using X-PLOR 26 , the model was rebuilt, side chains were added, and the Exd loops and N-terminal arms were built with the program O (ref. 27). The ®rst four residues of Exd, the residues from -7 to 4 of Ubx and the ®rst 6 residues of Ubx were disordered. There was clear density for the YPWM motif, but it was not readily interpretable for residues other than the tryptophan side chain. To obtain a more interpretable map, we re®ned and improved the MIRAS phases by solvent¯attening and extended them to 2.8 A Ê using the program SHARP 28 . This map was greatly improved and showed us how to ®t the YPWM motif. The YPWM ®t was further veri®ed by an anomalous-difference Fourier map calculated with data measured from selenomethionine (SeMet)-substituted protein; this map showed the positions of the three substituted seleniums, including the one in the YPWM motif. The re®nement of the structure was extended to 2.4 A Ê resolution using the native 1 data, and the structure veri®ed through extensive simulated annealing omit maps. Finally, 110 water molecules were added from the inspection of F o 2 F c maps. The ®nal re®ned structure has good stereochemistry, with the Ramachandran plot showing 84.5% of the residues in the core allowed regions and no residues in the disallowed or generously allowed regions.Received 18 December 1998; accepted 3 February 1999. The giant muscle protein titin (connectin) is essential in the temporal and spatial control of the assembly of the highly ordered sarcomeres (contractile units) of striated muscle. Here we present the crystal structure of titin's only catalytic domain, an autoregulated serine kinase (titin kinase). The structure shows how the active site is inhibited by a tyrosine of the kinase domain. We describe a dual mechanism of activation of titin kinase that consists of phosphorylation of this tyrosine and binding of calcium/calmodulin to the regulatory tail. The serine kinase domain of titin is the first known non-arginine-aspartate kinase to be activated by phosphorylation. The phosphorylated tyrosine is not located in the activation segment, as in other kinases, but in the P þ 1 loop, indicating that this tyrosine is a binding partner of the titin kinase substrate. Titin kinase phosphorylates the muscle protein telethonin in early differentiating myocytes, indicating that this kinase may act in myofibrillogenesis.Protein kinases are important in controlling cell proliferation and differentiation and they require specific mechanisms of regulation and substrate recognition [1][2][3] . Tight control of the enzymatic activity of protein kinases is achieved by phosphorylation of specific residues in the activation segment of the catalytic domain, sometimes combined with reversible conforma...

show abstract

S100.alpha., CAPL, and CACY: molecular cloning and expression analysis of three calcium-binding proteins from human heart

Cited by 84 publications

References 55 publications

Identification of Human Epidermal Differentiation Complex (EDC)-Encoded Genes by Subtractive Hybridization of Entire YACs to a Gridded Keratinocyte cDNA Library

Identification of Human Epidermal Differentiation Complex (EDC)-Encoded Genes by Subtractive Hybridization of Entire YACs to a Gridded Keratinocyte cDNA Library

Human S100A4 (p9Ka) induces the metastatic phenotype upon benign tumour cells

Erratum: Genomic-sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori

Contact Info

Product

Resources

About