Safety of raw meat and shellfish in Vietnam: An analysis of Escherichia coli isolations for antibiotic resistance and virulence genes

Van, Thi Thu Hao; Chin, James; Chapman, Toni A.; Tran, Linh Thuoc; Coloe, Peter J.

doi:10.1016/j.ijfoodmicro.2008.03.029

Cited by 282 publications

(186 citation statements)

References 55 publications

Supporting

Mentioning

144

Contrasting

Unclassified

Order By: Relevance

“…16 The high occurrence of ciprofloxacin resistance (75.9%) in our isolates is in accordance with some other reports from Asia, 15,17 but it is in contrast to a report from Vietnam. 18 As expected, the incidence of resistance to nalidixic acid, which is a simple quinolone, was higher (93.1%) and in agreement with some earlier reports. 4 Aminoglycosides are an important group of bactericidal drugs that are very effective against Gram-negative bacteria.…”

Section: Discussionsupporting

confidence: 91%

See 1 more Smart Citation

A profile of drug resistance genes and integrons in E. coli causing surgical wound infections in the Faisalabad region of Pakistan

et al. 2009

View full text Add to dashboard Cite

Escherichia coli are one of the leading causes of infection in wounds. Emerging multiple drug resistance among E. coli poses a serious challenge to antimicrobial therapy for wounds. This study was conducted to ascertain a baseline profile of antimicrobial resistance in E. coli isolates infecting surgical wounds. A total of 64 pus samples from hospitalized patients were screened and 29 (45.3%) were found to have E. coli, which were identified biochemically and confirmed by molecular methods. Using the disc diffusion method, antimicrobial resistance was observed toward tetracycline (100%), cefradine (100%), nalidixic acid (93.1%), ampicillin (86.2%), gentamicin (86.2%), cefixime (82.8%), ceftriaxone (82.8%), aztreonam (82.8%), ciprofloxacin (75.9%), streptomycin (72.4%), cefoperazone (65.5%), chloramphenicol (58.6%) and amikacin (58.6%). In an effort to find relevant genes, 11 different genes were targeted by PCR. Among these, the mutated gyrA gene was found to be the most prevalent (82.8%), followed by the TEM (72.4%), catP (68.9%), catA1 (68.9%), tetB (62.1%), blt (58.6%), bla CTXÀMÀ15 (27.6%), bla TEM (20.7%), bla OXA (17.2%), tetA (17.2%) and aadA1 (13.8%) genes. The presence of integrons was also studied among these isolates. The prevalence of class 1 integrons was the highest (44.8%), followed by class 2 (27.6%). Three (10.3%) isolates carried both class 1 and class 2 integrons (first report from E. coli infecting wounds). The high incidence of integrons points toward their facilitation for carriage of antimicrobial resistance genes; however, in nearly 37% isolates, no integrons were detected, indicating the significance of alternative mechanisms of gene transfer. Another salient finding was that all isolates were multidrug-resistant E. coli.

show abstract

Section: Discussionsupporting

confidence: 91%

“…Similar results have been reported earlier from Vietnam. 18 Twenty-two (75.9%) isolates were positive for either one or both of the tetA and tetB genes. However, we found neither of these genes in 24.1% isolates.…”

Section: Discussionmentioning

confidence: 99%

A profile of drug resistance genes and integrons in E. coli causing surgical wound infections in the Faisalabad region of Pakistan

et al. 2009

View full text Add to dashboard Cite

show abstract

“…Beta-lactams are widely used in veterinary medicine for treating infections caused by E. coli in companion animals (Li et al 2007). In E. coli, the CITM gene cluster encodes AmpC β-lactamase which hydrolyses β-lactams (Van et al 2008). Detection of bla(SHV) in 6 (42.9%) of the examined isolates, suggested high prevalence of this SHV β-lactamase-encoding gene (Feria et al 2002, Ojdana et al 2014.…”

Section: 4% a A D ( A 1 ) T E T ( A ) T E T ( B ) D F R ( A 1 ) S mentioning

confidence: 99%

Detection of virulence and antimicrobial resistance genes in Escherichia coli isolates from diarrhoiec dogs in Iran

Torkan¹,

Bahadoranian²,

Khamesipour³

et al. 2016

Arch. med. vet.

View full text Add to dashboard Cite

“…PCR assay was carried out as described by [34]. Using primers Beta-lactams gene resistant MRSA Mec A F (GTGAAGATATACCAAGTGATT) and R (GTGAAGATATACCAAGTGATT) gave 147 bp PCR product of mecA gene from strains Staphylococcus epidermidis and/also using primer Beta-lactams gene resistant for E. coli bla C (F) TGGCCAGAACTGACAGGCAAA (R) TTTCTCCTGAACGTGGCTGGC 462 [35,34]. The final PCR products were visualized using UV-trans-illuminator after electrophoresis on 1.5% agarose gel containing 50 mg/mL EtBr.…”

Section: Polymerase Chain Reaction (Pcr)mentioning

confidence: 99%

Antimicrobial, Antiviral Activity and GC-MS Analysis of Essential Oil Extracted from Achillea fragrantissima Plant Growing In Sinai Peninsula, Egypt

Zeedan¹

2014

J Microb Biochem Technol

View full text Add to dashboard Cite

Medicinal plants are considered new resources for producing agents that could act as alternatives to antibiotics in treatment of antibiotic-resistant bacteria. The present study aimed to evaluate the efficacy of essential oil extracted from Achillea fragrantissima plant growing in Egypt for antimicrobial, antiviral activities and chemical composition analyzed by Gas Chromatography-Mass Spectrometry (GC-MS). We also performed determination of essential oil antimicrobial activity by agar desk diffusion method and Minimal Inhibitory Concentration (MIC). Also, antiviral activity on ORF virus by pock reduction test was performed. It was reduced virus titer from 5.9 to 1.00 at 180 minutes. Detection of beta lactams resistant bacteria (Gram-positive bacteria Staphylococcus aureus, Staphylococcus epidermidis (MRSA) and Gram-negative bacteria Escherichia coli) by PCR with primers of mecA gene and Bela gene. The essential oil obtained by hydrodistillation was analyzed by GC-MS. The major components were found to be Santolina triene (1.97%), 2,5,5-trimethyl-3,6-heptadien-2-ol (8.23%) Eucalyptol 8.17, trans-2,7-Dimethyl-4,6octadien-2-ol (24.40%), 1,5-Heptadien-4-one-3,6-trimethyl (7.65%), Artemisia alcohol (3.49%), à Thujone (33.97%), Cissabinol (1.92%), Lavandulol (0.71%), 2-Octen-4-ol, 2-methyl (2.02%), 3-Cyclohexen1ol,4-methyl1 (1 methylethyl) (CAS) (2.15%), à terpineol ( 0.05% ), Estragole (0.71%) Lavandulyl acetate (0.49%), Sabinyl acetate (2.12 %), Germacrened (0.94%). Finally, our study proved that the essential oil has bactericidal effect on some bacterial resistant antibiotic (Gram-positive bacteria Staphylococcus aureus, Staphylococcus epidermidis (MRSA) and Gram-negative bacteria Escherichia coli ) as well as antiviral activity on ORF virus but it is still need further extensive studies for safety and drug interaction. Antimicrobial, Antiviral Activity and GC-MS Analysis of Essential IntroductionMedicinal plants still constitute one of the major source of drugs in modern as well as traditional medicine throughout the world [1,2]. Since a long period of time, plants have been a valuable source of natural products for maintaining animals and human health [2,3]. The development of multidrug-resistant(MDR) bacteria takes place because of the accumulation of different antibiotic resistance mechanisms inside the same strain which able to live in the presence of antibiotics drugs so that standard treatments become ineffective [4,[14][15][16]. Although, the pharmacological companies have produced a number of new antibiotics recently, but even then microorganism resistance to antibiotics increased throughout the world [5,7]. This situation has attract attention of researchers towards herbal products for developing and improve the antibacterial drugs quality [6,7].Natural products of higher plants may possess a new source of antimicrobial agents with possibly novel mechanisms for treatment of infectious diseases [8,9]. Medicinal plants contain active principles which can be used as alternative effective herbal dru...

show abstract

Safety of raw meat and shellfish in Vietnam: An analysis of Escherichia coli isolations for antibiotic resistance and virulence genes

Cited by 282 publications

References 55 publications

A profile of drug resistance genes and integrons in E. coli causing surgical wound infections in the Faisalabad region of Pakistan

A profile of drug resistance genes and integrons in E. coli causing surgical wound infections in the Faisalabad region of Pakistan

Detection of virulence and antimicrobial resistance genes in Escherichia coli isolates from diarrhoiec dogs in Iran

Antimicrobial, Antiviral Activity and GC-MS Analysis of Essential Oil Extracted from Achillea fragrantissima Plant Growing In Sinai Peninsula, Egypt

Contact Info

Product

Resources

About