Sal-Site: Research Resources for the Mexican Axolotl

Baddar, Nour W. Al Haj; Woodcock, M. Ryan; Khatri, Shivam; Voss, S. Randal

doi:10.1007/978-1-4939-2495-0_25

Cited by 18 publications

(15 citation statements)

References 14 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…For comparison, the A. mexicanum transcriptome assembly (Smith et al, 2005; Voss et al, 2015; Baddar et al, 2015; Voss, 2016) contained 89% (381/429) of eukaryote BUSCOs and 65% (1,953/3,023) of vertebrate BUSCOs. The SMARTer cDNA synthesis followed by Nextera-XT library prep did not exclude expected salamander transcripts.…”

Section: Resultsmentioning

confidence: 99%

Transcriptome analysis illuminates the nature of the intracellular interaction in a vertebrate-algal symbiosis

Burns

Zhang

Hill

et al. 2017

eLife

View full text Add to dashboard Cite

During embryonic development, cells of the green alga Oophila amblystomatis enter cells of the salamander Ambystoma maculatum forming an endosymbiosis. Here, using de novo dual-RNA seq, we compared the host salamander cells that harbored intracellular algae to those without algae and the algae inside the animal cells to those in the egg capsule. This two-by-two-way analysis revealed that intracellular algae exhibit hallmarks of cellular stress and undergo a striking metabolic shift from oxidative metabolism to fermentation. Culturing experiments with the alga showed that host glutamine may be utilized by the algal endosymbiont as a primary nitrogen source. Transcriptional changes in salamander cells suggest an innate immune response to the alga, with potential attenuation of NF-κB, and metabolic alterations indicative of modulation of insulin sensitivity. In stark contrast to its algal endosymbiont, the salamander cells did not exhibit major stress responses, suggesting that the host cell experience is neutral or beneficial.DOI: http://dx.doi.org/10.7554/eLife.22054.001

show abstract

Section: Resultsmentioning

confidence: 99%

Transcriptome analysis illuminates the nature of the intracellular interaction in a vertebrate-algal symbiosis

Burns

Zhang

Hill

et al. 2017

eLife

View full text Add to dashboard Cite

show abstract

“…Tblastn was used to mine nucleotide sequences from databases including NCBI, Ensembl, Sal-site [ 25 ], and newt transcriptomes [ 26 , 27 ] ( S1 Table ). Multiple sequence alignments were calculated using MUSCLE [ 28 ] and MAFFT [ 29 ] and inspected and modified using Jalview [ 30 ] and ClustalX [ 31 ].…”

Section: Methodsmentioning

confidence: 99%

Mechanism of Action of Secreted Newt Anterior Gradient Protein

et al. 2016

View full text Add to dashboard Cite

Anterior gradient (AG) proteins have a thioredoxin fold and are targeted to the secretory pathway where they may act in the ER, as well as after secretion into the extracellular space. A newt member of the family (nAG) was previously identified as interacting with the GPI-anchored salamander-specific three-finger protein called Prod1. Expression of nAG has been implicated in the nerve dependence of limb regeneration in salamanders, and nAG acted as a growth factor for cultured newt limb blastemal (progenitor) cells, but the mechanism of action was not understood. Here we show that addition of a peptide antibody to Prod1 specifically inhibit the proliferation of blastema cells, suggesting that Prod1 acts as a cell surface receptor for secreted nAG, leading to S phase entry. Mutation of the single cysteine residue in the canonical active site of nAG to alanine or serine leads to protein degradation, but addition of residues at the C terminus stabilises the secreted protein. The mutation of the cysteine residue led to no detectable activity on S phase entry in cultured newt limb blastemal cells. In addition, our phylogenetic analyses have identified a new Caudata AG protein called AG4. A comparison of the AG proteins in a cell culture assay indicates that nAG secretion is significantly higher than AGR2 or AG4, suggesting that this property may vary in different members of the family.

show abstract

“…Total RNA obtained was reverse transcribed using iScript cDNA Synthesis Kit (Bio‐Rad, Hercules, CA). Gene‐specific primers were designed using sequences collected from the Ambystoma Gene Collection as follows: Sox2_ F_ISH CATGACAAAGCACATGCACA, Sox2_R_ISH GCAAATGACAG AGCCGAACT, Vasa_F_ISH ATGGTGATCGGCTACAAAGG, Vasa_R_ ISH AGCTTTGCCAACATTTCCAC, Oct4_F_ISH GAAACATGCGCCAA GATGTA, Oct4_R_ISH GAAGCCAAAGAAAGCAAACG, Nanog_ F_ISH GGCATGTGAACCTCCGTAAG, Nanog_R_ISH TCAAAATGGA CGCTGAAATG, PiwiL1_F_ISH AACTGGCAGGGCATTATCAG, PiwiL1_R_ISH TCAACACCGCCATTTAACAA, PiwiL2_F_ISH GGCCA GGTACCATACGTGTT, PiwiL2_R_ISH AGCCTACATTGGTGGGAATG, 15_F_ISH CCCTCCTTTCCTTTTGCTTT, BMP15_R_ISH GTGGGATGC TCTGATCCACT, Lhx8_F_ISH TCCAACCTTCTAGGCTGTCG, Lhx8_R_ISH CAAAGGCTGGAGTCCAAGTG using Primer322, amplified via Frenche PCR Kit (Intron Biotechnology, Korea), and visualized on 1% agarose gels.…”

Section: Methodsmentioning

confidence: 99%

Regulation of Injury-Induced Ovarian Regeneration by Activation of Oogonial Stem Cells

2016

View full text Add to dashboard Cite

Some animals have the ability to generate large numbers of oocytes throughout life. This raises the question whether persistent adult germline stem cell populations drive continuous oogenesis and whether they are capable of mounting a regenerative response after injury. Here we demonstrate the presence of adult oogonial stem cells (OSCs) in the adult axolotl salamander ovary and show that ovarian injury induces OSC activation and functional regeneration of the ovaries to reproductive capability. Cells that have morphological similarities to germ cells were identified in the developing and adult ovaries via histological analysis. Genes involved in germ cell maintenance including Vasa, Oct4, Sox2, Nanog, Bmp15, Piwil1, Piwil2, Dazl, and Lhx8 were expressed in the presumptive OSCs. Colocalization of Vasa protein with H3 mitotic marker showed that both oogonial and spermatogonial adult stem cells were mitotically active. Providing evidence of stemness and viability of adult OSCs, enhanced green fluorescent protein (EGFP) adult OSCs grafted into white juvenile host gonads gave rise to EGFP OSCs, and oocytes. Last, the axolotl ovaries completely regenerated after partial ovariectomy injury. During regeneration, OSC activation resulted in rapid differentiation into new oocytes, which was demonstrated by Vasa 1 /BrdU 1 coexpression. Furthermore, follicle cell proliferation promoted follicle maturation during ovarian regeneration. Overall, these results show that adult oogenesis occurs via proliferation of endogenous OSCs in a tetrapod and mediates ovarian regeneration. This study lays the foundations to elucidate mechanisms of ovarian regeneration that will assist regenerative medicine in treating premature ovarian failure and reduced fertility. STEM CELLS 2017;35:236-247 SIGNIFICANCE STATEMENTStem cells that orchestrate ovarian regeneration have never been studied in the axolotl. This animal can regenerate many tissues perfectly, thus studying the underlying mechanisms of ovarian regeneration in this organism has great potential for translational outcomes. Many women suffer from premature ovarian failure and reduced fertility. With recent understanding of oogonial stem cells in vertebrates, inducing ovarian regeneration by therapeutic means is a desired application. Deciphering initiation and progression of ovarian regeneration via oogonial stem cells, in an animal that shows conservation of genes utilized in mammalian oogenesis, has great potential impact in the field of regenerative medicine.

show abstract

Sal-Site: Research Resources for the Mexican Axolotl

Cited by 18 publications

References 14 publications

Transcriptome analysis illuminates the nature of the intracellular interaction in a vertebrate-algal symbiosis

Transcriptome analysis illuminates the nature of the intracellular interaction in a vertebrate-algal symbiosis

Mechanism of Action of Secreted Newt Anterior Gradient Protein

Regulation of Injury-Induced Ovarian Regeneration by Activation of Oogonial Stem Cells

Contact Info

Product

Resources

About