SARS-CoV-2 outbreak in a tri-national urban area is dominated by a B.1 lineage variant linked to a mass gathering event

Stange, Madlen; Mari, Alfredo; Roloff, Tim; Seth-Smith, Helena M. B.; Schweitzer, Michael; Brunner, Myrta; Leuzinger, Karoline; Søgaard, Kirstine Kobberøe; Gensch, Alexander; Tschudin‐Sutter, Sarah; Fuchs, Simon; Bielicki, Julia; Pargger, Hans; Siegemund, Martin; Nickel, Christian H.; Bingisser, Roland; Osthoff, Michael; Bassetti, Stefano; Schneider-Sliwa, Rita; Battegay, Manuel; Hirsch, Hans H.; Egli, Adrian

doi:10.1371/journal.ppat.1009374

Cited by 46 publications

(37 citation statements)

References 47 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…We did not find any mutation in the potential escape motifs, nor minority alleles in the samples that would hint at intra-host diversity. The variant distribution across RdRp is in line with the distribution observed in the global dataset, with the exception of a high frequency of a synonymous mutation in nucleotide position 15,324 (located in RdRp), recently described within a Basel-area specific lineage [30] (Supplementary Figure S5). We determined phylogenetic (pangolin nomenclature) lineages of the genomes carrying potential escape motif mutations [34], and found that they are distributed across 37 different lineages in 21 countries.…”

Section: Potential Escape Mutants In the Global Datasetsupporting

confidence: 85%

“…Degenerate base calls in the variant call other than N were not determining the exclusion of the genome from the dataset. Using our COVGAPgenomes pipeline [30], the sequences were first aligned to the Wuhan-1 reference [31] using mafft v7.467, point mutations were identified with snp-sites v2.5.1 [32]. The collected variants were then annotated using snpeff v4.5covid19 [33].…”

Section: Global Dataset Spatiotemporal Trends and Genome Entropymentioning

confidence: 99%

“…The procedure followed to routine-diagnose patients and to sequence the Basel open cohort viral genomes is described in Stange et al, 2020 [30]. The region harbouring the two potential escape motifs was amplified from the samples from the longitudinal cohort using primers Fwd:AGGAATTACTTGTGTATGCTGCTGA and Rev:TAACATGTTGTGCCAACCACCA, resulting in a 701 bp fragment.…”

Section: Diagnosis and Sequencingmentioning

confidence: 99%

See 2 more Smart Citations

Global Genomic Analysis of SARS-CoV-2 RNA Dependent RNA Polymerase Evolution and Antiviral Drug Resistance

et al. 2021

Self Cite

View full text Add to dashboard Cite

A variety of antiviral treatments for COVID-19 have been investigated, involving many repurposed drugs. Currently, the SARS-CoV-2 RNA-dependent RNA polymerase (RdRp, encoded by nsp12-nsp7-nsp8) has been targeted by numerous inhibitors, e.g., remdesivir, the only provisionally approved treatment to-date, although the clinical impact of these interventions remains inconclusive. However, the potential emergence of antiviral resistance poses a threat to the efficacy of any successful therapies on a wide scale. Here, we propose a framework to monitor the emergence of antiviral resistance, and as a proof of concept, we address the interaction between RdRp and remdesivir. We show that SARS-CoV-2 RdRp is under purifying selection, that potential escape mutations are rare in circulating lineages, and that those mutations, where present, do not destabilise RdRp. In more than 56,000 viral genomes from 105 countries from the first pandemic wave, we found negative selective pressure affecting nsp12 (Tajima’s D = −2.62), with potential antiviral escape mutations in only 0.3% of sequenced genomes. Potential escape mutations included known key residues, such as Nsp12:Val473 and Nsp12:Arg555. Of the potential escape mutations involved globally, in silico structural models found that they were unlikely to be associated with loss of stability in RdRp. No potential escape mutation was found in a local cohort of remdesivir treated patients. Collectively, these findings indicate that RdRp is a suitable drug target, and that remdesivir does not seem to exert high selective pressure. We anticipate our framework to be the starting point of a larger effort for a global monitoring of drug resistance throughout the COVID-19 pandemic.

show abstract

Section: Potential Escape Mutants In the Global Datasetsupporting

confidence: 85%

Section: Global Dataset Spatiotemporal Trends and Genome Entropymentioning

confidence: 99%

Section: Diagnosis and Sequencingmentioning

confidence: 99%

See 1 more Smart Citation

Global Genomic Analysis of SARS-CoV-2 RNA Dependent RNA Polymerase Evolution and Antiviral Drug Resistance

et al. 2021

Self Cite

View full text Add to dashboard Cite

show abstract

“…See Refs. Nadeau et al (2021 ), Illumina COVIDSeq Test (2021 ), ARTIC (2021 ), Health Genome Center github (2021 ), Posada-Céspedes et al (2021) , Stange et al (2021 ), Chevin (2011 ), Seabold and Perktold (2010 ), Huisman et al (2020 ), Cori et al (2013 ) and Coronavirus (2021 ).…”

Section: Supplementary Datamentioning

confidence: 99%

Quantification of the spread of SARS-CoV-2 variant B.1.1.7 in Switzerland

Chen¹,

Nadeau²,

Topolsky³

et al. 2021

Epidemics

Self Cite

View full text Add to dashboard Cite

Background In December 2020, the United Kingdom (UK) reported a SARS-CoV-2 Variant of Concern (VoC) which is now named B.1.1.7. Based on initial data from the UK and later data from other countries, this variant was estimated to have a transmission fitness advantage of around 40–80 % (Volz et al., 2021; Leung et al., 2021; Davies et al., 2021). Aim This study aims to estimate the transmission fitness advantage and the effective reproductive number of B.1.1.7 through time based on data from Switzerland. Methods We generated whole genome sequences from 11.8 % of all confirmed SARS-CoV-2 cases in Switzerland between 14 December 2020 and 11 March 2021. Based on these data, we determine the daily frequency of the B.1.1.7 variant and quantify the variant’s transmission fitness advantage on a national and a regional scale. Results We estimate B.1.1.7 had a transmission fitness advantage of 43–52 % compared to the other variants circulating in Switzerland during the study period. Further, we estimate B.1.1.7 had a reproductive number above 1 from 01 January 2021 until the end of the study period, compared to below 1 for the other variants. Specifically, we estimate the reproductive number for B.1.1.7 was 1.24 [1.07–1.41] from 01 January until 17 January 2021 and 1.18 [1.06–1.30] from 18 January until 01 March 2021 based on the whole genome sequencing data. From 10 March to 16 March 2021, once B.1.1.7 was dominant, we estimate the reproductive number was 1.14 [1.00–1.26] based on all confirmed cases. For reference, Switzerland applied more non-pharmaceutical interventions to combat SARS-CoV-2 on 18 January 2021 and lifted some measures again on 01 March 2021. Conclusion The observed increase in B.1.1.7 frequency in Switzerland during the study period is as expected based on observations in the UK. In absolute numbers, B.1.1.7 increased exponentially with an estimated doubling time of around 2–3.5 weeks. To monitor the ongoing spread of B.1.1.7, our plots are available online.

show abstract

“…MGEs cover different types of event and contexts such as public and private celebrations, festivals, religious events and pilgrimages, sporting and touristic events, and political meetings. The crucial role of MGEs in the global propagation of the disease has been evidenced in several countries, including China [ 3 ], Iran [ 4 ], Malaysia [ 5 ], Italy [ 6 ], Spain [ 7 ], France [ 8 ], Germany [ 9 ], Jordan [ 10 ], Malta [ 11 ], Switzerland [ 12 ], and Malawi [ 13 ]. Significant international efforts have been made to implement specific measures, risk assessment and surveillance, and event cancellations in order to prevent the spread of SARS-CoV-2 from MGEs [ 14 – 17 ].…”

Section: Introductionmentioning

confidence: 99%

“Mass gathering events and COVID-19 transmission in Borriana (Spain): A retrospective cohort study”

Domènech-Montoliu¹,

Pac-Sa²,

Vidal-Utrillas³

et al. 2021

PLoS ONE

View full text Add to dashboard Cite

Objective Mass gathering events (MGEs) are associated with the transmission of COVID-19. Between 6 and 10 March 2020, several MGEs related to the Falles festival took place in Borriana, a municipality in the province of Castellon (Spain). The aim of this study was to estimate the incidence of COVID-19 and its association with these MGEs, and to quantify the potential risk factors of its occurrence. Methods During May and June 2020, a population-based retrospective cohort study was carried out by the Public Health Center of Castelló and the Hospital de la Plana in Vila-real. Participants were obtained from a representative sample of 1663 people with potential exposure at six MGEs. A questionnaire survey was carried out to obtain information about attendance at MGEs and COVID-19 disease. In addition, a serologic survey of antibodies against SARS-Cov-2 was implemented. Inverse probability weighted regression was used in the statistical analysis. Results A total of 1338 subjects participated in the questionnaire survey (80.5%), 997 of whom undertook the serologic survey. Five hundred and seventy cases were observed with an attack rate (AR) of 42.6%; average age was 36 years, 62.3% were female, 536 cases were confirmed by laboratory tests, and 514 cases were found with SARS-CoV-2 total antibodies. Considering MGE exposure, AR was 39.2% (496/1264). A dose-response relationship was found between MGE attendance and the disease, (adjusted relative risk [aRR] = 4.11 95% confidence interval [CI]3.25–5.19). Two MGEs with a dinner and dance in the same building had higher risks. Associated risk factors with the incidence were older age, obesity, and upper and middle class versus lower class; current smoking was protective. Conclusions The study suggests the significance of MGEs in the COVID-19 transmission that could explain the subsequent outbreak in Borriana.

show abstract

SARS-CoV-2 outbreak in a tri-national urban area is dominated by a B.1 lineage variant linked to a mass gathering event

Cited by 46 publications

References 47 publications

Global Genomic Analysis of SARS-CoV-2 RNA Dependent RNA Polymerase Evolution and Antiviral Drug Resistance

Global Genomic Analysis of SARS-CoV-2 RNA Dependent RNA Polymerase Evolution and Antiviral Drug Resistance

Quantification of the spread of SARS-CoV-2 variant B.1.1.7 in Switzerland

“Mass gathering events and COVID-19 transmission in Borriana (Spain): A retrospective cohort study”

Contact Info

Product

Resources

About