Screening a large reference sample to identify very low frequency sequence variants: comparisons between two genes

Abstract

Most human sequence variation is in the form of single-nucleotide polymorphisms (SNPs). It has been proposed that coding-region SNPs (cSNPs) be used for direct association studies to determine the genetic basis of complex traits. The success of such studies depends on the frequency of disease-associated alleles, and their distribution in different ethnic populations. If disease-associated alleles are frequent in most populations, then direct genotyping of candidate variants could show robust associations in manageable study samples. This approach is less feasible if the genetic risk from a given candidate gene is due to many infrequent alleles. Previous studies of several genes demonstrated that most variants are relatively infrequent (<0.05). These surveys genotyped small samples (n<75) and thus had limited ability to identify rare alleles. Here we evaluate the prevalence and distribution of such rare alleles by genotyping an ethnically diverse reference sample that is more than six times larger than those used in previous studies (n=450). We screened for variants in the complete coding sequence and intron-exon junctions of two candidate genes for neuropsychiatric phenotypes: SLC6A4, encoding the serotonin transporter; and SLC18A2, encoding the vesicular monoamine transporter. Both genes have unique roles in neuronal transmission, and variants in either gene might be associated with neurobehavioral phenotypes.

A Large Case–Control Study of Common Functional SLC6A4 and BDNF Variants in Obsessive–Compulsive Disorder

“…Genotyping for SLC6A4 5-HTTLPR, rs25531, STin2, and I425V/I425L polymorphisms was performed by PCR/restriction enzyme digestion in duplicate for all samples: one time exactly as described previously (Wendland et al, 2006b), and a second time with a modified protocol scoring the loss-of-function P339L polymorphism (Glatt et al, 2001;Prasad et al, 2005) in addition to the above mentioned loci. Oligonucleotide primer sequences for P339L were CCCCTGCTGTGTTCCAGGTGTGG and CGAGGCCGTCGG TCCAATCACC; primers were diluted to 200 nM final concentration each and amplified a 211 bp large fragment (Figure 1), which was digested during the subsequent double restriction endonuclease incubation into 60 and 151 bp fragments by HpaII for the Pro339 allele, but not for Leu339.…”

Molecular Genetics of the Platelet Serotonin System in First-Degree Relatives of Patients with Autism

“…A control sample known to contain the SLC6A4 Ile425Val variant (Glatt et al, 2001) from the DNA Polymorphism Discovery Resource (DPDR, http://locus. umdnj.edu/nigms/pdr.html) was used to confirm assay performance.…”

Functional SLITRK1 var321, varCDfs and SLC6A4 G56A variants and susceptibility to obsessive-compulsive disorder

“…[2][3][4] In the same population of our 322 OCD probands and 390 controls, allelic frequencies for G56A (Table 2) did not differ significantly between probands and controls and are in agreement with previous reports. 2,12 We identified one Ala56 homozygote in the US Caucasian control population (Coriell NA17267); all other Ala56 alleles occurred as heterozygotes.…”