Screening and Evaluation of Stable Reference Genes for Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) Analysis in Chinese Fir Roots under Water, Phosphorus, and Nitrogen Stresses

Chen, Ranhong; Chen, Wanting; Tigabu, Mulualem; Zhong, Weimin; Li, Yushan; Ma, Xiao; Li, Ming

doi:10.3390/f10121087

Cited by 12 publications

(4 citation statements)

References 53 publications

(41 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The amplification program was 95 °C for 3 min followed by 40 cycles of 95 °C for 20 s, 60 °C for 30 s, and 72 °C for 30 s. The specificity of the amplification was controlled by melting curve analysis (from 65 to 95 °C). We used β-Actin1(Forward: 5′- CTCTCTCAGCACCTTCGAGCAG − 3′, Reverse: 5′- TCCACATACAACCGCTCCACTG − 3′) as a reference gene to normalize expression level [ 10 ]. The relative expression of genes in different Pi treatments over time was calculated by 2 −ΔΔCt method.…”

Section: Methodsmentioning

confidence: 99%

Transcriptome analysis provides insights into the root response of Chinese fir to phosphorus deficiency

et al. 2021

Self Cite

View full text Add to dashboard Cite

Background Phosphorus is one of the essential elements for plant growth and development, but available phosphorus (Pi) content in many soil types is low. As a fast-growing tree species for timber production, Chinese fir is in great demand of Pi, and the lack of Pi in soil restricts the increase of productivity of Chinese fir plantation. Root morphology and the synthesis and secretion of organic acids play an important role in the uptake of phosphorus, but the molecular mechanisms of Chinese fir root responses to Pi deficiency are largely unexplored. In this study, seedlings of Yang 061 clone were grown under three Pi supply levels (0, 5 and 10 mg·L-1 P) and morphological attributes, organic acid content and enzyme activity were measured. The transcriptome data of Chinese fir root system were obtained and the expression levels of phosphorus responsive genes and organic acid synthesis related genes on citric acid and glyoxylate cycle pathway were determined. Results We annotated 50,808 Unigenes from the transcriptome of Chinese fir roots. Among differentially expressed genes, seven genes of phosphate transporter family and 17 genes of purple acid phosphatase family were up-regulated by Pi deficiency, two proteins of SPX domain were up-regulated and one was down-regulated. The metabolic pathways of the citric acid and glyoxylate cycle pathway were mapped, and the expression characteristics of the related Unigenes under different phosphorus treatments were analyzed. The genes involved in malic acid and citric acid synthesis were up-regulated, and the activities of the related enzymes were significantly enhanced under long-term Pi stress. The contents of citric acid and malic acid in the roots of Chinese fir increased after 30 days of Pi deficiency. Conclusion Chinese fir roots showed increased expression of genes related with phosphorus starvation, citrate and malate synthesis genes, increased content of organic acids, and enhanced activities of related enzymes under Pi deficiency. The results provide a new insight for revealing the molecular mechanism of adaption to Pi deficiency and the pathway of organic acid synthesis in Chinese fir roots.

show abstract

Section: Methodsmentioning

confidence: 99%

Transcriptome analysis provides insights into the root response of Chinese fir to phosphorus deficiency

et al. 2021

Self Cite

View full text Add to dashboard Cite

show abstract

“…Since different statistical algorithms were applied, these differences in screening of optimal internal reference genes were acceptable. Finally, the RefFinder algorithm was used to comprehensively compare and rank these reference genes [33], suggesting that UBQ was the best reference gene in different tissues and growth of leaves, and IDH and PLA were the optimum references for gene expression normalization during the growth of corms and leafstalks, respectively. Based on the results that mentioned above, it is concluded that UBQ is the most suitable reference gene in arrowhead tissues.…”

Section: Discussionmentioning

confidence: 99%

Selection of Reliable Reference Genes for Gene Expression Normalization in Sagittaria trifolia

Tang

Liu

et al. 2023

Genes

View full text Add to dashboard Cite

Real-time quantitative PCR (RT-qPCR) is a method with high sensitivity and convenience that has been extensively used to analyze the expression level of target genes. A reference gene with a highly stable expression is required to ensure the accuracy of experimental results. However, the report on appropriate reference genes in arrowheads (Sagittaria trifolia) is still limited. In this study, eight candidate reference genes (ACT5, UBQ, GAPDH, CYP, NAC, IDH, SLEEPER and PLA) were selected. The candidate genes were employed in a RT-qPCR assay in different tissues at different developmental stages of the same tissue (including corm, leaf and leafstalk) in arrowheads. Five statistical algorithms, GeNorm, NormFinder, BestKeeper, delta cycle threshold (ΔCt) and RefFinder, were used to evaluate the stability of these genes’ expressions in order to identify the appropriate reference genes. The results showed that UBQ was the optimum reference gene in leaf, leafstalk, root, stolon and corm, IDH exhibited the most stable expression during the expansion of corm, UBQ and PLA were the most stable reference genes in developmental stages of leaf and leafstalk, respectively. Finally, the reliability of reference genes was further confirmed by the normalization of PDS and EXP1 genes under different arrowhead tissues and developmental stages of corm, respectively. This study constitutes important guidance for the selection of reliable reference genes for analyzing the tissue- and developmental-stage-specific expression of genes in arrowheads.

show abstract

“…Quantitative real-time PCR was performed and analyzed using GoTag qPCR Master Mix (Promega) and a StepOnePlus™ real-time fluorescence quantitative PCR instrument (Corbett Research, Australia). β-Actin1 was used as a reference gene to normalize expression data, as this gene was found to be stable [35]. The primers for amplifying β-Actin1 were 5 -CTCTCTCAGCACCTTCGAGCAG-3 (Forward) and 5 -TCCACATACAACCGCTCCACTG-3 (Reverse).…”

Section: Expression Of the Clphr1 Gene In Roots Stems And Leaves Of mentioning

confidence: 99%

Cloning, Characterization and Expression Analysis of the Phosphate Starvation Response Gene, ClPHR1, from Chinese Fir

Chen

Zhang

et al. 2020

Forests

Self Cite

View full text Add to dashboard Cite

The study on the function and sequence of PHR1 (Phosphate Starvation Response gene 1) gene, which plays a central role in plant phosphorus (Pi) signal regulatory network, is of great significance to further study response mechanisms to Pi deficiency. In this work, the previously selected Pi-efficient Chinese fir clone M32 was used as research material to obtain the full-length sequence of ClPHR1 transcription factors in Chinese fir by RACE (Rapid Amplification of cDNA Ends) full-length cloning technique, and the structure, function and subcellular localization of ClPHR1 gene encoding protein were analyzed. The temporal and spatial expression characteristics of ClPHR1 transcription factors in Chinese fir under low Pi stress were also analyzed, and the overexpression of ClPHR1 gene in transgenic Arabidopsis thaliana was obtained to verify the function of ClPHR1 gene under low Pi stress. The results showed that the length of the ClPHR1 gene obtained by rapid amplification of cDNA ends technique was 1954 bp, of which 1512 bp was an open reading frame. ClPHR1 was predicted to be an unstable hydrophilic protein with only one possible transmembrane domain. The ClPHR1 gene had a highly conserved MYB-CC domain, which is similar to the PHR1 gene of other plants. Phylogenetic tree analysis showed that the sequence had high homology with PHR1 genes in the Prunus species. The ClPHR1 was expressed in all organs of Chinese fir, with the highest expression in the roots, followed by the leaves with the lowest expression in stems. ClPHR1 expression in roots was reduced dramatically at the beginning of Pi stress treatment and followed by an increase at 7days; in leaves, it increased dramatically at the beginning of Pi starvation treatment and showed a decreasing trend after 3 days; in stems, the expression level of ClPHR1 increased after 7 days of Pi stress treatment. The transient expression vector was introduced into plant cells, and it was found that ClPHR1 was located in the nucleus and was a MYB-CC transcription factor expressed in the cell nucleus. The ClPHR1 overexpression vector was constructed, and then introduced into Arabidopsis thaliana by agrobacterium infection inflorescence method. The expressions of Pi transporter genes, AtPHT1;1, AtPHT1;2, AtPHT1;8 and AtPHT1;9, was significantly higher in the overexpressing strain than that in the wild type strain. The results suggest that the ClPHR1 transcription factor could regulate the regulation of downstream Pi transporter gene and increase Pi utilization efficiency of the Chinese fir under Pi stress.

show abstract

Screening and Evaluation of Stable Reference Genes for Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) Analysis in Chinese Fir Roots under Water, Phosphorus, and Nitrogen Stresses

Cited by 12 publications

References 53 publications

Transcriptome analysis provides insights into the root response of Chinese fir to phosphorus deficiency

Transcriptome analysis provides insights into the root response of Chinese fir to phosphorus deficiency

Selection of Reliable Reference Genes for Gene Expression Normalization in Sagittaria trifolia

Cloning, Characterization and Expression Analysis of the Phosphate Starvation Response Gene, ClPHR1, from Chinese Fir

Contact Info

Product

Resources

About