Screening and purification of NanB sialidase from Pasteurella multocida with activity in hydrolyzing sialic acid Neu5Acα(2–6)Gal and Neu5Acα(2–3)Gal

Nugroho, Christian Marco Hadi; Kurnia, Ryan Septa; Tarigan, Simson; Silaen, Otto Sahat Martua; Triwidyaningtyas, Silvia; Wibawan, I Wayan Teguh; Natalia, Lily; Takdir, Andi Khomeini; Soebandrio, Amin

doi:10.1038/s41598-022-13635-x

Cited by 11 publications

(18 citation statements)

References 54 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Based on the calculation of the speci c activity and comparison between total sialidase activity and total protein, the results of puri cation showed that at least 258 mU/ml was obtained. The enzymes obtained in this study are in accordance with previous studies which have succeeded in producing sialidase derived from Pasteurella multocida bacterial cells (Nugroho et al 2022). Observation of cytotoxicity in MDCK cells was carried out by gradual doses 32 mU/ml, 64 mU/ml, 129 mU/ml, and 258 mU /ml of sialidase.…”

Section: Resultssupporting

confidence: 90%

“…The spectrophotometer was used to measure absorbance readings at a wavelength of 405 nm. (Kurnia et al 2022a;Nugroho et al 2022) The effect of sialidase on viral replication was evaluated by exposing MDCK cells, previously treated with the enzyme and subsequently challenged with the H9N2 virus to evaluate the effectiveness of sialidase in hindering viral replication. Monolayer MDCK cells on 96-well plates.…”

Section: Bacterial Culture and Sialidase Puri Cationmentioning

confidence: 99%

“…Nicholls et al 2013;Nugroho et al 2022). Administration of sialidase with various doses indicates that hydrolysis capability is greatly in uenced by the amount of sialidase enzyme administered.…”

mentioning

confidence: 99%

See 2 more Smart Citations

In Vitro Antiviral Activity of NanB Bacterial Sialidase Against Avian Influenza H9N2 Virus in MDCK cells

Nugroho

Silaen

Kurnia³

et al. 2023

Preprint

Self Cite

View full text Add to dashboard Cite

Avian influenza virus are infectious agent that may cause global health problem issues in poultry and potentially zoonotic. The high risk of circulating antiviral agents due to genetic mutations is a concern, highlighting the need for development of new antiviral agents. In this study the antiviral activity of NanB sialidase from P. multocida was investigated through in vitro analysis using MDCK cells. NanB sialidase were purified from P. multocida for testing its toxicity and its ability to hydrolyze its sialic acid receptors on MDCK cells. H9N2 challenge virus was adapted in MDCK cells until cytopathic effects (CPE) appeared. Antiviral activity of NanB sialidase was conducted using MDCK cells, and then observed based on cell morphology, viral copy number, and expression of apoptosis-mediating genes. NanB sialidase effectively hydrolyze Neu5Acα(2–6)Gal sialic acid at the dose of 129 mU/ml, while at 258 mU/ml it cause toxicity on MDCK cells. Antiviral activity of sialidase is evident based on the significantly decrease in viral copy number at all doses administrated. The increase of p53 and caspase-3 expression was observed in infected cells without sialidase and highest dose of 258 mU/ml sialidase, indicating the occurrence of apoptosis mechanism. Our study demonstrates the ability of NanB sialidase to inhibit H9N2 virus replication based on observations of sialic acid hydrolysis, reduction in viral copy number, and expression of apoptosis-related genes. The future application of sialidase may be considered as an antiviral strategy against avian influenza H9N2 virus infections.

show abstract

Section: Resultssupporting

confidence: 90%

Section: Bacterial Culture and Sialidase Puri Cationmentioning

confidence: 99%

See 1 more Smart Citation

In Vitro Antiviral Activity of NanB Bacterial Sialidase Against Avian Influenza H9N2 Virus in MDCK cells

Nugroho

Silaen

Kurnia³

et al. 2023

Preprint

Self Cite

View full text Add to dashboard Cite

show abstract

“…The sequencing of amplicons that only showed positive NanH, NanI, and NanJ of each isolate was performed by the 1st base sequencing service agency in Malaysia. Sequencing data were analyzed using MEGA X and Bioedit software to compare the nucleotide sequence of the current isolate with the sialidase gene of the C. perfringens isolate in the GenBank database [12 , 20] .…”

Section: Methodsmentioning

confidence: 99%

Clostridium perfringens sialidase interaction with Neu5Ac α-Gal sialic acid receptors by in-silico observation and its impact on monolayers cellular behavior structure

Kurnia,

Soebandrio,

Harun

et al. 2024

J Adv Vet Anim Res

View full text Add to dashboard Cite

Objective: This study aims to evaluate the effect of Clostridium perfringens sialidase treatment on monolayer cell behavior using computational screening and an in vitro approach to demonstrate interaction between enzyme-based drugs and ligands in host cells. Materials and Methods: The in silico study was carried out by molecular docking analysis used to predict the interactions between atoms that occur, followed by genetic characterization of sialidase from a wild isolate. Sialidase, which has undergone further production and purification processes exposed to chicken embryonic fibroblast cell culture, and observations-based structural morphology of cells compared between treated cells and normal cells without treatment. Results: Based on an in silico study, C. perfringens sialidase has an excellent binding affinity with Neu5Acα (2.3) Gal ligand receptor with Gibbs energy value (ΔG)—7.35 kcal/mol and Ki value of 4.11 μM. Wild C. perfringens isolates in this study have 99.1%–100% similarity to the plc gene, NanH, and NanI genes, while NanJ shows 93.18% similarity compared to the reference isolate from GenBank. Sialidase at 750 and 150 mU may impact the viability, cell count, and cell behavior structure of fibroblast cells by significantly increasing the empty area and perimeter of chicken embryo fibroblast (CEF) cells, while at 30 mU sialidase shows no significant difference compared with mock control. Conclusion: Sialidase-derived C. perfringens has the capacity to compete with viral molecules for attachment to host sialic acid based on in silico analysis. However, sialidase treatment has an impact on monolayer cell fibroblasts given exposure to high doses.

show abstract

“…The total RNA was quantified on a NanoDrop spectrophotometer (BioDrop, UK) with a wavelength of 260 nm. Quantitative real time-polymerase chain reaction (qRT-PCR) assays were performed using similar procedure from Nugroho, et al 47 The BDNF mRNA expression analysis was performed using qRT-PCR applied Biosystem with ReverTra ® qPCR RT Master Mix/gDNA remover kit (Toyobo Bio-Tech). The presence of BDNF and GAPDH was detected with a primary from: BDNF -NeuroD1, forward 5’-AAGCCATGAATGCAGAGGAGGACT-3’; reverse: AGCTGCAGGCAGCCGGCGACC), GAPDH forward 5’-TGCACCACCAACTGCTTAGC-3’ and reverse 5’-GGCATGGACTGTGGTCATGAG-3’.…”

Section: Methodsmentioning

confidence: 99%

The Oil Formulation Derived from Moringa Oleifera Seeds Ameliorates Behavioral Abnormalities in Water-immersion Restraint Stress Mouse Model

Purwoningsih¹,

Arozal²,

Lee³

et al. 2022

JEP

View full text Add to dashboard Cite

Purpose Repeated stress events are well known to be associated with the onset of behavioral abnormalities including depression, anxiety and memory impairment. In spite of the traditional uses of Moringa oleifera (MO), no experimental evidence for its use against chronic stress exists. Here, we investigated whether seed oil from MO (MOO) could improve behavior abnormalities of chronic stress mice induced by water-immersion restraint stress (WIRS) and the underlying mechanism. Methods BALB/C male mice at 12 weeks of age were exposed to chronic WIRS for two weeks and divided in to four groups: normal group, WIRS group, WIRS+MOO1 group (treated with MOO at the dose of 1 mL/kg BW), and WIRS+MOO2 group (treated with MOO 2 mL/kg BW). The MOO treatment was given orally for 23 days. On day 24, we checked the behavior parameters, the plasma level of cortisol, acetylcholinesterase (AChE) activity in hippocampus, mRNA expression level of brain-derived neurotrophic factor ( BDNF ) and oxidative stress parameters in brain tissues. In addition, we also checked the histopathological features of the gastric mucosa wall. Results Administration of MOO ameliorated anxiety-like, depression-like and memory impairment phenotypes in the WIRS mouse model although the plasma cortisol concentrations were comparable among the groups. Of note, MOO both in two doses could suppress the AChE activity in hippocampus tissue and ameliorated the MDA level in prefrontal cortex tissue in mice exposed to WIRS. Although only WIRS+MOO2 group could increase the mRNA expression of BDNF , the histopathological gastric mucosa wall features were improved in all MOO groups. Conclusion Taken together, these finding suggested that MOO may have a neuroprotective effect in the mouse model of WIRS as evidenced by improving the abnormal behaviors through enhancing mRNA expression level of BDNF , inhibited AChE activity, and prevented the increase of MDA level in the brain.

show abstract

Screening and purification of NanB sialidase from Pasteurella multocida with activity in hydrolyzing sialic acid Neu5Acα(2–6)Gal and Neu5Acα(2–3)Gal

Cited by 11 publications

References 54 publications

In Vitro Antiviral Activity of NanB Bacterial Sialidase Against Avian Influenza H9N2 Virus in MDCK cells

In Vitro Antiviral Activity of NanB Bacterial Sialidase Against Avian Influenza H9N2 Virus in MDCK cells

Clostridium perfringens sialidase interaction with Neu5Ac α-Gal sialic acid receptors by in-silico observation and its impact on monolayers cellular behavior structure

The Oil Formulation Derived from Moringa Oleifera Seeds Ameliorates Behavioral Abnormalities in Water-immersion Restraint Stress Mouse Model

Contact Info

Product

Resources

About