Sediment-associated microbial community profiling: sample pre-processing through sequential membrane filtration for 16S rRNA amplicon sequencing

Abstract

Background Sequential membrane filtration as a pre-processing step for capturing sediment-associated microorganisms could provide good quality and integrity DNA that can be preserved and kept at ambient temperatures before community profiling through culture-independent molecular techniques. However, the effects of sample pre-processing via filtration on DNA-based profiling of sediment-associated microbial community diversity and composition are poorly understood. Specifically, the influences of pre-processing on the quality and quantity of extracted DNA, high-throughput DNA sequencing reads, and detected microbial taxa need further evaluation. Results We assessed the impact of pre-processing freshwater sediment samples by sequential membrane filtration (from 10, 5 to 0.22 μm pore size) for 16S rRNA-based community profiling of sediment-associated microorganisms. Specifically, we examined if there would be method-driven differences between non- and pre-processed sediment samples regarding the quality and quantity of extracted DNA, PCR amplicon, resulting high-throughput sequencing reads, microbial diversity, and community composition. We found no significant difference in the qualities and quantities of extracted DNA and PCR amplicons, and the read abundance after bioinformatics processing (i.e., denoising and chimeric-read filtering steps) between the two methods. Although the non- and pre-processed sediment samples had more unique than shared amplicon sequence variants (ASVs), we report that their shared ASVs accounted for 74% of both methods’ absolute read abundance. More so, at the genus level, the final collection filter identified most of the genera (95% of the reads) captured from the non-processed samples, with a total of 51 false-negative (2%) and 59 false-positive genera (3%). We demonstrate that while there were differences in shared and unique taxa, both methods revealed comparable microbial diversity and community composition. Conclusions Our observations highlight the feasibility of pre-processing sediment samples for community analysis and the need to further assess sampling strategies to help conceptualize appropriate study designs for sediment-associated microbial community profiling.

Exploring the diversity and structural response of sediment-associated microbiota communities to environmental pollution at the siangshan wetland in Taiwan using environmental DNA metagenomic approach

“…Proteobacteria are reported in both HMs contaminated and uncontaminated regions (Ma et al, 2015;Yan et al, 2016). Previous studies documented the response of Proteobacteria to HMs contamination in polluted habitats (Hu et al, 2021;Liu et al, 2021b;Serrana and Watanabe, 2022). Bacteroidota (class Bacteroidia) and Cyanobacteria (class Cyanobacteria) were more abundant phyla in surface sediments of MA1.F with relative abundances of 23.91% and 26.40%, respectively.…”

Integrative omics analysis reveals insights into small colony variants of Staphylococcus aureus induced by sulfamethoxazole-trimethoprim

“…The mixtures were incubated at 37 °C for 35 min, followed by heating at 100 °C for 15 min, and then centrifuged at 12,000 rpm for 10 min. The supernatant containing soluble DNA was used for amplifying the 16S rRNA gene using universal primers 16 s-F (AGAGTTTGATCCTGGCTCAG) and 16 s-R (GGTTACCTTGTTACGACTT) [ 42 ]. All PCR products were sent to Shanghai Maple Sequencing Co. for bi-directional sequencing, and the results were compared to the BLAST/NCBI website ( https://blast.ncbi.nlm.nih.gov/Blast.cgi ) to confirm their specificity to S. aureus .…”

Effect of Eurotium cristatum on Saccharification Efficiency, Microorganisms in Mold Culture, and Liquor Flavor during Wuliangye Liquor Production

“…The colony diversity of the mold culture samples was analyzed at FeiFan Standard Technical Service (Suzhou) Co., Ltd. Bacterial diversity was measured via the 16S rDNA method. [ 16 ] Fungal diversity was examined via the ITS method. [ 17 ] These procedures were performed as follows: (1) bacterial DNA and fungal RNA were extracted from the mold culture samples; (2) the universal primers of the bacterial DNA and the fungal RNA were added and PCR amplified; and (3) base sequences were tested, and bacterial genus was identified through evolutionary tree analysis.…”