Seleção de progênies de café arábica com resistência à ferrugem alaranjada

Shigueoka, Luciana Harumi; Sera, Gustavo Hiroshi; Sera, Tumoru; Fonseca, Inês Cristina de Batista; Mariucci, Valdir; Andreazi, Elder; Carvalho, Filipe Gimenez; Gardiano, Cristiane Gonçalves; Carducci, Fernando Cesar

doi:10.1590/1984-70332014v14n2a16

Cited by 10 publications

(8 citation statements)

References 7 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…For the species, C. arabica, the expression of several agronomic traits have been reported to be highly related to the expression of genetic diversity among cultivars (Carvalho et al, 2012;DaMatta, 2004;Del Grossi et al, 2013;Martinez et al, 2011;Martins et al, 2015;Rodrigues et al, 2014Rodrigues et al, , 2015Shigueoka et al, 2014). Additionally, the estimative of coefficient of genotypic determinations were higher than 90% for MRR, LFG and BER ( Table 1), showing that these traits are especially valuable in the genetic study of the recovery, since genetic factors seems to have major contribution in the determination of the phenotypic values of these traits.…”

Section: Resultsmentioning

confidence: 99%

Coffee pruning: Importance of diversity among genotypes of Coffea arabica

Rodrigues¹,

Martins²,

Apostólico³

et al. 2017

Afr. J. Agric. Res.

View full text Add to dashboard Cite

The renovation of Arabica coffee crops located in mountain regions should be based on the use of new improved genotypes and increased plant density, which require the establishment of an adequate pruning system. Little is known about the response of improved genotypes to pruning, therefore this study was done to evaluate the vegetative and reproductive recovery after pruning of genotypes of Arabica coffee cultivated in environment with high plant density, in order to identify how the different patterns of recovery may influence the crop after pruning. The experiment was developed in Espírito Santo state (Brazil), where 16 genotypes of Arabica coffee were cultivated in a randomized block design, with four repetitions (six plants per plot) and pruned after their fourth harvest. The 2-years period after pruning was evaluated to quantify the potential recovery and variability of behavior were found, making it possible to identify groups of genotypes of different behavior regarding the green coffee yield, grain size, growth rate and formation of new vegetative structures. The results show that not all genotypes recovered in the same speed after pruning, being possible to highlight some genotypes with better performance post-pruning. This fact shows the importance of genetic factors; more specifically the recovery, growth and coffee yield aft er the intervention; should not be ignored when deciding on the best method to renew the plantation. The decision on which cultivar and which pruning method to use should be a rational choice, based on the possible synergy between those technologies.

show abstract

Section: Resultsmentioning

confidence: 99%

Coffee pruning: Importance of diversity among genotypes of Coffea arabica

Rodrigues¹,

Martins²,

Apostólico³

et al. 2017

Afr. J. Agric. Res.

View full text Add to dashboard Cite

show abstract

“…A scale of scores ranging from 1 to 5 was used, where: R: TGCAGATTGATGGCACGTTA 56 0 F: TGATTTCGCTTGTTGTCGAG 1 = plants without chlorotic lesions in the leaves; 2 = plants with lesions ranging from "flecks" to chlorosis in the infected area, but without the formation of uredospores; 3 = uredosporic pustules in small amounts (1-25% of leaves), usually in the lower third, with lower severity in the middle third; 4 = uredosporic pustules in 26 -50% of leaves, usually in the lower and middle third, with beginning of leaf fall; 5 = uredosporic pustules in more than 50% of the leaves, from the lower third to the upper third, with high intensity of leaf fall. Plants with scores 1 and 2 were classified as resistant, and those with scores 3, 4, and 5, as susceptible (Shigueoka et al 2014).…”

Section: Methodsmentioning

confidence: 99%

Assisted selection using molecular markers linked to rust resistance SH3 gene in Coffea arabica

Silva,

Ariyoshi,

Shigueoka

et al. 2023

Crop Breed. Appl. Biotechnol.

View full text Add to dashboard Cite

The aim of this work was to validate markers linked to the SH3 gene of coffee leaf rust (CLR) resistance and use them in assisted selection. Initially, we validated the markers in genotypes already known to carry SH3. Next, we performed phenotype and genotype evaluation for resistance to CLR in coffee plants growing under field conditions. We used Arabica coffee progenies derived from BA-10, which carries the SH3 gene due to introgression of C. liberica. Three SCAR markers (SP-M16-SH3, BA-48-21O-f, and BA-124-12K-f) and one SSR marker (Sat244) linked to SH3 gene were used to amplify the coffee plants' DNA. Our assessments of markers validation in resistant genotypes, SP-M16-SH3 and BA-124-12K-f, were efficient to identify the SH3 gene. These two markers were used to evaluate the progenies derived from BA-10 and were significantly linked to the phenotype evaluations. The SP-M16-SH3 marker was more efficient, with the advantage of being codominant.

show abstract

“…The estimative of genetic parameters shows the existence of considerable variation between genotypes for both systems. Genotypic differences causing expressions of different agronomic traits in C. arabica have been widely reported, such as for biometry of reproductive branches (Rodrigues et al, 2014a), nutritional parameters (Martinez et al, 2011;Moura et al, 2015;Martins et al, 2015;Rodrigues et al, 2015), resistance of plant diseases (Sera et al, 2010;Del Grossi et al, 2013;Rodrigues et al, 2014b;Shigueoka et al, 2014), drought tolerance (DaMatta, 2004;Nardini et al, 2014), and crop yield (Carvalho et al, 2012;Rodrigues et al, 2014c).…”

Section: Genetic Variability Among Genotypes In the Rainfed Farming Smentioning

confidence: 99%

Genetic variability and expression of agro-morphological traits among genotypes of Coffea arabica being promoted by supplementary irrigation

et al. 2017

View full text Add to dashboard Cite

The use of supplementary irrigation to sustain the plantation during moments of severe water stress or moments of high water demand is becoming almost a norm to keep sustainable crops, especially due to the climate changes and the high frequency in which climate extremes are occurring lately. The objective of this study was to evaluate the agronomic performance and expression of genetic variability among genotypes of Coffea arabica L. cultivated in farming systems with different levels of water supply, focusing on rainfed or supplementary irrigated systems. The experiment was developed in competition field, testing 8 genotypes of C. arabica L. in rainfed or supplementary irrigated systems. The growth and production were evaluated during 2 consecutive cycles (2014-2015 and 2015-2016). Among the growth gains, it was observed large gains in coffee yield, but the magnitude of the gains varied among genotypes. For crop yield, for example, Paraíso MG/H 419-1 presented 136% gain, while Oeiras MG-6851 was capable of yielding as much more coffee in rainfed conditions than in irrigated system. The expression of variability for some agronomic traits (such as coffee yield, canopy size, growth rate, and number of new buds) may be intensified by the supplementary water supply, which promotes gains in production and growth, increases the magnitude of variation among genotypes and allows to identify different patterns for selection, which may not be observed in the rainfed systems.

show abstract

Seleção de progênies de café arábica com resistência à ferrugem alaranjada

Abstract: - 'IAPAR 59' and 'Tupi IAC 1669-33' and having a large number of plants with complete rust resistance.

Cited by 10 publications

References 7 publications

Coffee pruning: Importance of diversity among genotypes of Coffea arabica

Coffee pruning: Importance of diversity among genotypes of Coffea arabica

Assisted selection using molecular markers linked to rust resistance SH3 gene in Coffea arabica

Genetic variability and expression of agro-morphological traits among genotypes of Coffea arabica being promoted by supplementary irrigation

Contact Info

Product

Resources

About