Selection for high muscle fat in rainbow trout induces potentially higher chylomicron synthesis and PUFA biosynthesis in the intestine

Kamalam, Biju Sam; Panserat, Stéphane; Aguirre, Pierre; Geurden, Inge; Fontagné-Dicharry, Stéphanie; Médale, Françoise

doi:10.1016/j.cbpa.2012.11.020

Cited by 41 publications

(25 citation statements)

References 68 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…A 1-g sample of the resulting total RNA was reverse transcribed into cDNA using the SuperScript III reverse transcriptase kit (Invitrogen), and random primers (Promega, Charbonniéres, France), according to the manufacturers' instructions. Target gene expression abundance was determined by quantitative real-time (q)RT-PCR, using specific primers (35,39,81). Primers targeting malic enzyme (forward: TACGTGCG-GTGTGTGTGACG; reverse: GTGCCCACATCCAGCATGAC), were newly designed using Primer3 software.…”

Section: Gene Expression Analysismentioning

confidence: 99%

Hepatic fatty acid biosynthesis is more responsive to protein than carbohydrate in rainbow trout during acute stimulations

Dai

Panserat

Kaushik

et al. 2016

American Journal of Physiology-Regulatory, Integrative and Comp

View full text Add to dashboard Cite

(DNL) remains debatable in carnivorous fish. We aimed to evaluate and compare the response of hepatic lipogenic gene expression to dietary carbohydrate intake/glucose and dietary protein intake/amino acids (AAs) during acute stimulations using both in vivo and in vitro approaches. For the in vivo trial, three different diets and a controlledfeeding method were employed to supply fixed amount of dietary protein or carbohydrate in a single meal; for the in vitro trial, primary hepatocytes were stimulated with a low or high level of glucose (3 mM or 20 mM) and a low or high level of AAs (one-fold or four-fold concentrated AAs). In vitro data showed that a high level of AAs upregulated the expression of enzymes involved in DNL [fatty acid synthase (FAS) and ATP citrate lyase (ACLY)], lipid bioconversion [elongation of very long chain fatty acids like-5 (Elovl5), Elovl2, ⌬6 fatty acyl desaturase (D6D) and stearoyl-CoA desaturase-1 (SCD1)], NADPH production [glucose-6-phosphate dehydrogenase (G6PDH) and malic enzyme (ME)], and transcriptional factor sterol regulatory element binding protein 1-like, while a high level of glucose only elevated the expression of ME. Data in trout liver also showed that high dietary protein intake induced higher lipogenic gene expression (FAS, ACLY, and Elovl2) regardless of dietary carbohydrate intake, while high carbohydrate intake markedly suppressed the expression of acetyl-CoA carboxylase (ACC) and Elovl5. Overall, we conclude that, unlike rodents or humans, hepatic fatty acid biosynthetic gene expression in rainbow trout is more responsive to dietary protein intake/AAs than dietary carbohydrate intake/glucose during acute stimulations. This discrepancy probably represents one important physiological and metabolic difference between carnivores and omnivores. target of rapamycin; fatty acid biosynthesis; lipogenesis; protein; carbohydrate; rainbow trout DE NOVO LIPOGENESIS (DNL) is the metabolic pathway that synthesizes fatty acids from excess carbon donors; these fatty acids can then be converted into triglycerides, the major energy storage form in vertebrates (43,83,85). In mammals, hepatic lipogenesis is very responsive to dietary modifications (40). Consumption of a diet rich in carbohydrates stimulates the lipogenic pathway, whereas consumption of a diet rich in lipids and poor in carbohydrates, or rich in polyunsaturated fatty acids decreases this metabolic pathway (40,86). A highcarbohydrate diet can induce hyperglycemia, thereby stimulating lipogenesis via several mechanisms (40). First, by being glycolytically converted to acetyl-CoA, glucose provides substrate for fatty acid synthesis. Secondly, glucose stimulates glycolytic and lipogenic gene expression (24). Finally, glucose stimulates the release of insulin from the pancreas, thereby activating insulin/Akt signaling pathway (40, 69), which stimulates hepatic lipogenesis via the transcription factor sterol regulatory element binding protein-1c (SREBP-1c) (32). Regarding dietary protein, rodent data showed that the meta...

show abstract

Section: Gene Expression Analysismentioning

confidence: 99%

Hepatic fatty acid biosynthesis is more responsive to protein than carbohydrate in rainbow trout during acute stimulations

Dai

Panserat

Kaushik

et al. 2016

American Journal of Physiology-Regulatory, Integrative and Comp

View full text Add to dashboard Cite

show abstract

Section: Relative Quantification Of Mrna and Mirnamentioning

confidence: 99%

“…The primer sequences used in the real-time RT-PCR assays as well as the protocol conditions of the assays for mRNA of glucose and amino acid metabolic genes (Kamalam et al, 2012;Kamalam et al, 2013) and miRNAs (Mennigen et al, 2012) have previously been published. The transcripts analysed were glucokinase (GK; EC 2.7.1.2), hexokinase 1 (HK1; EC 2.7.1.1), 6-phosphofructo-1-kinase (6PFK; EC 2.7.1.11) and pyruvate kinase Formulation and proximate composition of the two experimental diets used during the first-feeding stimulus (VLP and HP) Supplied the following (kg −1 diet): calcium carbonate (40% Ca) 2.15 g, magnesium oxide (60% Mg) 1.24 g, ferric citrate 0.2 g, potassium iodide (75% I) 0.4 mg, zinc sulphate (36% Zn) 0.4 g, copper sulphate (25% Cu) 0.3 g, manganese sulphate (33% Mn) 0.3 g, dibasic calcium phosphate (20% Ca, 18% P) 5 g, cobalt sulphate 2 mg, sodium selenite (30% Se) 3 mg, potassium chloride 0.9 g, sodium chloride 0.4 g. (PK; EC 2.7.1.40) for glycolysis; glucose-6-phosphatase (G6Pase; EC 3.1.3.9), fructose1,6-bisphosphatase (FBPase; EC 3.1.3.11) and phosphoenol pyruvate carboxykinase (PEPCK; EC 4.1.1.32) for gluconeogenesis; sodium-dependent glucose transporter 1 (SGLT1), and facilitative glucose transporters (GLUT1, GLUT2 and GLUT4) for glucose transporters; glutamate dehydrogenase (GDH, EC 1.4.1.2) and serine dehydratase (SDH, EC 4.3.1.17) for amino acid catabolism; Na + -dependent amino acid transporters (NBAT) and H + -dependent peptide transporter (PEPT1) for amino acid transporters; and amylase (EC 3.2.1.1) and maltase (EC 3.2.1.20) for carbohydrate digestion.…”

Section: Relative Quantification Of Mrna and Mirnamentioning

confidence: 99%

“…An amount of 1 μg of total RNA was used for cDNA synthesis. The NCode TM VILO TM miRNA cDNA Synthesis Kit (Invitrogen) or the SuperScript III RNaseH-Reverse Transcriptase Kit (Invitrogen) with random primers (Promega, Charbonniéres, France) was used according to the manufacturer's protocol to synthesize cDNA (n=9 for each time point) for miRNA and mRNA, respectively.The primer sequences used in the real-time RT-PCR assays as well as the protocol conditions of the assays for mRNA of glucose and amino acid metabolic genes (Kamalam et al, 2012;Kamalam et al, 2013) and miRNAs (Mennigen et al, 2012) have previously been published. The transcripts analysed were glucokinase (GK; EC 2.7.1.2), hexokinase 1 (HK1; EC 2.7.1.1), 6-phosphofructo-1-kinase (6PFK; EC 2.7.1.11) and pyruvate kinase (Dumortier et al, 2013;Ramírez et al, 2013).…”

mentioning

confidence: 99%

See 1 more Smart Citation

High or low dietary carbohydrate:protein ratios during first-feeding affect glucose metabolism and intestinal microbiota in juvenile rainbow trout

Geurden

Mennigen

Plagnes-Juan

et al. 2014

Journal of Experimental Biology

104

View full text Add to dashboard Cite

Based on the concept of nutritional programming in mammals, we tested whether an acute hyperglucidic-hypoproteic stimulus during first feeding could induce long-term changes in nutrient metabolism in rainbow trout. Trout alevins received during the five first days of exogenous feeding either a hyperglucidic (40% gelatinized starch + 20% glucose) and hypoproteic (20%) diet (VLP diet) or a high-protein (60%) glucose-free diet (HP diet, control). Following a common 105-day period on a commercial diet, both groups were then challenged (65 days) with a carbohydrate-rich diet (28%). Short-and long-term effects of the early stimuli were evaluated in terms of metabolic marker gene expressions and intestinal microbiota as initial gut colonisation is essential for regulating the development of the digestive system. In whole alevins (short term), diet VLP relative to HP rapidly increased gene expressions of glycolytic enzymes, while those involved in gluconeogenesis and amino acid catabolism decreased. However, none of these genes showed persistent molecular adaptation in the liver of challenged juveniles (long term). By contrast, muscle of challenged juveniles subjected previously to the VLP stimulus displayed downregulated expression of markers of glycolysis and glucose transport (not seen in the short term). These fish also had higher plasma glucose (9 h postprandial), suggesting impaired glucose homeostasis induced by the early stimulus. The early stimulus did not modify the expression of the analysed metabolism-related microRNAs, but had short-and long-term effects on intestinal fungi (not bacteria) profiles. In summary, our data show that a short hyperglucidic-hypoproteic stimulus during early life may have a long-term influence on muscle glucose metabolism and intestinal microbiota in trout. KEY WORDS: Nutritional programming, Rainbow trout, Carbohydrates, Protein, Metabolism INTRODUCTIONPrenatal or early nutritional neonatal events exerted during critical developmental windows may result in permanent changes in postnatal growth potential, health and metabolic status in mammals (Burdge and Lillycrop, 2010;Lucas, 1998;Patel and Srinivasan, 2002;Patel et al., 2009;Metges et al., 2014;Duque-Guimarães and Ozanne, 2013;Devaskar and Thamotharan, 2007). It has been RESEARCH ARTICLE 1 INRA, UR1067 Nutrition Metabolism and Aquaculture, F-64310 Saint-Pée-surNivelle, France. suggested that this process of developmental plasticity utilizes the early nutritional cues to prepare individual phenotypes to better match the predicted future nutritional environment (Gluckman et al., 2005). Possible biological mechanisms for 'imprinting' the nutritional event until adulthood in mammalian vertebrates comprise adaptive changes in gene expression pattern or cellular phenotype (epigenetic phenomenon), nutrient-sensitive signalling pathways and adaptive clonal selection, which may be transmitted to future offspring (Lucas, 1998;Symonds et al., 2009;Waterland and Jirtle, 2003;Gut and Verdin, 2013). Experimental data on the concept...

show abstract

“…A 1 µg sample of the resulting total RNA was reverse transcribed into cDNA using the SuperScript TM III Reverse Transcriptase kit (Invitrogen, Carlsbad, CA, USA) and random primers (Promega, Charbonniéres, France) according to the manufacturers' instructions. Target gene expression abundance was determined by quantitative realtime (q) RT-PCR, using specific primers [38][39][40][41][42]. Primers targeting alanine transaminase 2 (forward: TGGGTGCGTACAGTGCCAGT; reverse: GACGCACCCTCACCACACAC; Sigenae AU081029.s.om.10), aspartate transaminase 1 (forward: TCAAGAGTGGCAGGAACATCA; reverse: AGCGTCTCTGAAGATGGGTGT; Sigenae CA359859.s.om.10), aspartate transaminase 2 (forward: TCTGTGCCCAGTCCTTCTC; reverse: GGAGGGTTGGACCAGGT; Sigenae CA344854.s.om.10.)…”

Section: Gene Expression Analysismentioning

confidence: 99%

Amino Acids Attenuate Insulin Action on Gluconeogenesis and Promote Fatty Acid Biosynthesis via mTORC1 Signaling Pathway in trout Hepatocytes

Dai¹,

Panserat²,

Plagnes-Juan³

et al. 2015

Cell Physiol Biochem

View full text Add to dashboard Cite

Background/Aims: Carnivores exhibit poor utilization of dietary carbohydrates and glucose intolerant phenotypes, yet it remains unclear what are the causal factors and underlying mechanisms. We aimed to evaluate excessive amino acids (AAs)-induced effects on insulin signaling, fatty acid biosynthesis and glucose metabolism in rainbow trout and determine the potential involvement of mTORC1 and p38 MAPK pathway. Methods: We stimulated trout primary hepatocytes with different AA levels and employed acute administration of rapamycin to inhibit mTORC1 activation. Results: Increased AA levels enhanced the phosphorylation of ribosomal protein S6 kinase (S6K1), S6, and insulin receptor substrate 1 (IRS-1) on Ser³⁰² but suppressed Akt and p38 phosphorylation; up-regulated the expression of genes related to gluconeogenesis and fatty acid biosynthesis. mTORC1 inhibition not only inhibited the phosphorylation of mTORC1 downstream targets, but also blunted IRS-1 Ser³⁰² phosphorylation and restored excessive AAs-suppressed Akt phosphorylation. Rapamycin also inhibited fatty acid biosynthetic and gluconeogenic gene expression. Conclusion: High levels of AAs up-regulate hepatic fatty acid biosynthetic gene expression through an mTORC1-dependent manner, while attenuate insulin-mediated repression of gluconeogenesis through elevating IRS-1 Ser³⁰² phosphorylation, which in turn impairs Akt activation and thereby weakening insulin action. We propose that p38 MAPK probably also involves in these AAs-induced metabolic changes.

show abstract

Selection for high muscle fat in rainbow trout induces potentially higher chylomicron synthesis and PUFA biosynthesis in the intestine

Cited by 41 publications

References 68 publications

Hepatic fatty acid biosynthesis is more responsive to protein than carbohydrate in rainbow trout during acute stimulations

Hepatic fatty acid biosynthesis is more responsive to protein than carbohydrate in rainbow trout during acute stimulations

High or low dietary carbohydrate:protein ratios during first-feeding affect glucose metabolism and intestinal microbiota in juvenile rainbow trout

Amino Acids Attenuate Insulin Action on Gluconeogenesis and Promote Fatty Acid Biosynthesis via mTORC1 Signaling Pathway in trout Hepatocytes

Contact Info

Product

Resources

About