Selection of non-competitive leptin antagonists using a random nanobody-based approach

Abstract

The adipocyte-derived cytokine leptin acts as a metabolic switch, connecting the body's metabolism to high-energy consuming processes such as reproduction and immune responses. Accumulating evidence suggests that leptin plays a role in human pathologies, such as autoimmune diseases and cancer, thus providing a rationale for the development of leptin antagonists. In the present study, we generated and evaluated a panel of neutralizing nanobodies targeting the LR (leptin receptor). A nanobody comprises the variable domain of the naturally occurring single-chain antibodies found in members of the Camelidae family. We identified three classes of neutralizing nanobodies targeting different LR subdomains: i.e. the CRH2 (cytokine receptor homology 2), Ig-like and FNIII (fibronectin type III) domains. Only nanobodies directed against the CRH2 domain inhibited leptin binding. We could show that a nanobody that targets the Ig-like domain potently interfered with leptin-dependent regulation of hypothalamic NPY (neuropeptide Y) expression. As a consequence, daily intraperitoneal injection increased body weight, body fat content, food intake, liver size and serum insulin levels. All of these characteristics resemble the phenotype of leptin and LR-deficient animals. The results of the present study support proposed models of the activated LR complex, and demonstrate that it is possible to block LR signalling without affecting ligand binding. These nanobodies form new tools to study the mechanisms of BBB (blood-brain barrier) leptin transport and the effect of LR inhibition in disease models.

High efficiency cell-specific targeting of cytokine activity

“…This is not the case as shown in Fig. 2b since Nbs that bind different extracellular domains of the mLepR 22 evoke the same effect.…”

“…In order to establish the proof of the 'activity-by-targeting' concept for type I IFNs, we first fused a nanobody (Nb) 4.11 (ref. 22) directed against the murine leptin receptor (mLepR) to either WT human IFNa2 or the R149A mutant. This mutation reduces the affinity of IFN to its receptor by a factor 200 by increasing its dissociation rate constant of the interaction with IFNAR2, keeping the IFN-IFNAR2 on-rate and the IFN-IFNAR1 affinity intact 20 .…”

“…The ybbR-IFN sequences were amplified by a PCR Expand High Fidelity PCR system (Roche Diagnostics) and the following primers: Forward: 5 0 -GGGGGGTCCGGACCATCACCATCACCATCACCAT CACCATCACCCTGCTTCTCCCGCCTCCCCAGCATCACCTGCCAGCCCAG CAAGTGATAGCCTGGAATTTATTGC-3 0 , Reverse: 5 0 -CGTCTAGATCATTCC TTACTTCTTAAAC-3 0 in order to introduce a His tag sequence and a repeat of a sequence encoding five Pro-Ala-Ser residues at the 5 0 -end of the ybbR-IFNs. The PCR products were digested with BspEI and XbaI and cloned at the 3 0 -end of the sequences encoding nanobody (Nb) against the murine leptin receptor (mLepR) 4.10, 4.11 or 2.17, themselves cloned in fusion with the SIgK leader peptide sequence and the HA tag sequence into the pMET7 vector 22 . In order to construct pMET7 vector encoding Nb-PD-L2-IFN or NbGFP-IFN fusions, the Nb-encoding sequence of Nb-mLepR-IFN constructs was swapped with the sequences encoding Nb-PD-L2 or Nb-GFP obtained by PCR amplification from the plasmid pHEN6c-4PDII-122 or pcDNA3-GFP-VHH, respectively.…”

“…The mutation Q124R was introduced into the IFNa2 sequence by site-directed mutagenesis using the QuikChange II-E Site-Directed Mutagenesis Kit (Agilent Technologies). All Nbs were generated at the VIB Protein Service Facility as described previously 22 .…”

20 YEARS OF LEPTIN: Insights into signaling assemblies of the leptin receptor

“…Leptin and LR-specific antibodies or nanobodies (the variable domain of single-chain antibodies found in camelids) can prevent productive binding of leptin to its receptor (Fazeli et al 2006, Zabeau et al 2012, or block FN III-FN III clustering necessary for receptor activation (Zabeau et al 2012). Soluble LR variants trap free leptin in circulation and thereby compete with the membranebound receptor (De Rosa et al 2006).…”