Selection of Receptor-Binding Variants of Human Influenza A and B Viruses in Baby Hamster Kidney Cells

Abstract

Cultivation of human influenza viruses in the allantoic cavity of embryonated chicken eggs leads to a selection of receptor-binding variants with amino acid substitutions on the globular head of the hemagglutinin (HA) molecule. Such selection can be avoided by growing the human viruses in Madin Darby canine kidney (MDCK) cells. In the present study, we tested whether baby hamster kidney (BHK) cells select receptor-binding mutants of human influenza viruses. After isolating H1N1, H3N2, and type B influenza viruses from clinical samples in MDCK cells, we passaged them in either BHK cells or chicken eggs. The BHK-grown viruses differed from their MDCK-grown counterparts by virtue of mutations in the HA: 225D --> G (H1N1 virus), 128T --> A and 226I --> V (H3N2), and 187N --> D (type B) (H3 numbering). Variants with different substitutions were selected by passaging of the same MDCK-grown parents in eggs: 141L --> H, 208R --> H, and 225D --> G (H1N1), 194L --> I (H3N2), and 137G --> R (B). Compared with their MDCK-grown counterparts, both BHK- and egg-grown viruses possessed a higher affinity for the cellular membranes of BHK cells and of the chorioallantoic cells of chicken embryos and for a 3'-sialylgalactose-containing synthetic sialylglycopolymer. By contrast, changes in the affinity of mutants for a 6'-sialyl-(N-acetyllactosamine)-containing sialylglycopolymer varied from negative to positive. Fluorescence-activated cell-sorting analysis with linkage-specific lectins showed that the density of the 6'-sialyl-(N-acetyllactosamine)-containing receptors is substantially lower on the surface of BHK cells than on MDCK cells, providing an explanation for the growth restriction of human viruses in the former cells. Our data demonstrate that cultures of BHK cells, like eggs, can select receptor-binding variants of human influenza viruses.

Cell Culture-Selected Substitutions in Influenza A(H3N2) Neuraminidase Affect Drug Susceptibility Assessment

“…Pyrosequencing with customized nucleotide dispensation order was used to detect variants with changes at codons 148 and 151 (29). The nucleotide dispensation AGTAGCACATA GTCACGATCATCGTCTATCA(GATC) 5 enabled identification of the following NA variants: threonine (T; nucleotide sequence ACA), lysine (K; nucleotide sequence AAA), or isoleucine (I; nucleotide sequence ATA) at position 148 and aspartic acid (D; nucleotide sequence GAT), glycine (G; nucleotide sequence GGT), or asparagine (N; nucleotide sequence AAT) at position 151. Single-nucleotide polymorphism (SNP) analysis was done essentially as previously described (29) with the limit of detection set at 10%.…”

“…Many cell lines have been used for the propagation of influenza viruses, including baby hamster kidney (BHK-21) cells, rhesus monkey kidney epithelial (LLC-MK2) cells, and African green monkey kidney (Vero) cells (5)(6)(7)(8). The use of human colon intestinal epithelial (CaCo-2) cells for isolation and propagation of seasonal A(H3N2) viruses has also been advocated in recent years (9,10).…”

MDCK-SIAT1 Cells Show Improved Isolation Rates for Recent Human Influenza Viruses Compared to Conventional MDCK Cells

“…Many cell lines have been used, including BHK-21 (14), LLC-MK2 (38), SPJL (40), and Vero cells (11,12). Madin-Darby canine kidney (MDCK) cells, however, have proved to be the easiest to handle, the most sensitive, and the most reliable cell line (10,13,27,38) and remain the standard cell line for influenza virus propagation.…”

Characterization of a Porcine Lung Epithelial Cell Line Suitable for Influenza Virus Studies

“…Repeated addition of trypsin to the culture medium is also needed for multicycle growth of the influenza viruses (18). BHK cells also support replication of influenza viruses, but growth in BHK cells, like that in eggs, results in the selection of receptor-binding variants of human influenza viruses (11). MDCK cells are considered to be the best cell line for supporting the growth of influenza viruses, but this cell line causes cancer in nude mice (10; this study); MDCK cells have not been licensed for use in the production of vaccine.…”

“…The primary epithelial cells of human adenoid and primary rhesus monkey kidney tissue support replication of influenza viruses (6,21). Cell lines such as Vero, MRC-5, Madin-Darby canine kidney (MDCK), and baby hamster kidney (BHK) also support the growth of influenza viruses, but of these cell lines, MDCK is the best for isolation and propagation of influenza viruses (8,10,11,31).…”