Selective Up-Regulation of Intact, but Not Defective env RNAs of Endogenous Modified Polytropic Retrovirus by the Sgp3 Locus of Lupus-Prone Mice

Abstract

Endogenous retroviruses are implicated in the pathogenesis of systemic lupus erythematosus (SLE). Because four different classes of endogenous retroviruses, i.e., ecotropic, xenotropic, polytropic, or modified polytropic (mPT), are expressed in mice, we investigated the possibility that a particular class of endogenous retroviruses is associated with the development of murine SLE. We observed >15-fold increased expression of mPT env (envelope) RNA in livers of all four lupus-prone mice, as compared with those of nine nonautoimmune strains of mice. This was not the case for the three other classes of retroviruses. Furthermore, we found that in addition to intact mPT transcripts, many strains of mice expressed two defective mPT env transcripts which carry a deletion in the env sequence of the 3 portion of the gp70 surface protein and the 5 portion of the p15E transmembrane protein, respectively. Remarkably, in contrast to nonautoimmune strains of mice, all four lupus-prone mice expressed abundant levels of intact mPT env transcripts, but only low or nondetectable levels of the mutant env transcripts. The Sgp3 (serum gp70 production 3) locus derived from lupus-prone mice was responsible for the selective up-regulation of the intact mPT env RNA. Finally, we observed that single-stranded RNA-specific TLR7 played a critical role in the production of anti-gp70 autoantibodies. These data suggest that lupus-prone mice may possess a unique genetic mechanism responsible for the expression of mPT retroviruses, which could act as a triggering factor through activating TLR7 for the development of autoimmune responses in mice predisposed to SLE.

An intrinsic B‐cell defect supports autoimmunity in New Zealand black chromosome 13 congenic mice

“…However, an endogenous retrovirus is not a likely source of dsRNA in B6.NZBc13 mice, as almost all endogenous retroviruses are not replication competent due to post-integration mutations and deletions, suggesting a lack of active viral infection. Moreover, the Sgp3 locus was found to control the gp70 expression of a modified polytropic (mPT) provirus (ssRNA virus), and not of the xenotropic proviruses (NZB-X1 or NZB-X2) shown to accelerate anti-chromatin antibody production in NZB mice [28][29][30]. Interestingly, it has been previously reported that in vivo exposure to poly(I:C) potently increases serum gp70 levels in NZB mice, which suggested a potential role for gp70 as an acute phase reactant [31].…”

Early onset of autoimmune disease by the retroviral integrase inhibitor raltegravir

“…All RNA samples were treated with rDNase 1 (Ambion) before reverse transcription. RNA (100 ng) from each sample was reverse transcribed with oligo(dT) [12][13][14][15][16][17][18] using the SuperScript FirstStrand Synthesis System (Invitrogen). PCR primers were as follows: gp70 forward 5Ј CCGCGTCCCCATTGGGCCTAATCC 3Ј; gp70 reverse 5Ј GGACGGCAACCCCTTCG-TAGTAGG 3Ј.…”

“…While the exact identity of these loci is unknown, there is a strong link to endogenous retroviral expression in B/W mice: Mouse serum gp70 (produced by the liver) is very similar to MLV gp70 and is present in virtually every mouse strain, but only lupus-prone strains produce auto-antibodies to (retroviral) gp70 (14). In the production of anti-gp70 auto-antibodies, the Toll-like receptor 7 (TLR7) plays a critical role (15). Furthermore, mice deficient in TLR7, but not mice deficient in TLR9, have ameliorated lupus disease (16).…”

Activation of the innate immune response by endogenous retroviruses

“…First, the MuERV envelope glycoprotein, gp70, is considered to be an antigen against which a TLR7-dependent autoimmune response is directed in lupus-prone mice (Yoshinobu et al, 2009). The expression of gp70 is increased following activation of TLR7 and -9 in a mouse model of lupus (Baudino et al, 2010), providing a direct link between TLR activation and the upregulation of MuERV expression.…”

“…TLR7 was found to be involved in the germinal centre reaction, which facilitates antibody production and class switching, specifically in the acute response to murine exogenous retroviruses (Browne, 2011(Browne, , 2013. Furthermore, TLR7 was critical for the production of autoantibodies to gp70 (Yoshinobu et al, 2009), and mice lacking TLR7 were unable to produce antibodies to MuERVs (Yu et al, 2012). It was proposed that MuERVs are activated sporadically and that this allows for a protective, TLR7-dependent antibody response to control MuERV viraemia (Yu et al, 2012).…”