Self-Assembly of Tissue Transglutaminase into Amyloid-Like Fibrils Using Physiological Concentration of Ca²⁺

Abstract

Tissue transglutaminase (tTG or TG2) is a member of the transglutaminase family that catalyzes calcium dependent formation of isopeptide bonds. It has been shown that the expression of TG2 is elevated in neurodegenerative diseases such as Parkinson's, Huntington's, and Alzheimer's. We have investigated the self-assembly of TG2 in vitro. First, using software, hot spots, which are prone for aggregation, were identified in domain 2 of the enzyme. Next we expressed and purified recombinant TG2 and its truncated version that contains only the catalytic domain, and examined their amyloidogenic behavior in various conditions including different temperatures and pHs, in the presence of metal ions and Guanosine triphosphate (GTP). To analyze various stages leading to TG2 fibrillation, we employed various techniques including Thioflavin T (ThT) binding assay, Congo-Red, birefringence, Circular Dichroism (CD), 8-anilino-1-naphthalene sulfonic acid (ANS) binding, Transmission Electron Microscopy (TEM) and Atomic Force Microscopy (AFM). Our results indicated that using low concentrations of Ca(2+), TG2 self-assembled into amyloid-like fibrils; this self-assembly occurred at the physiological temperature (37 °C) and at a higher temperature (57 °C). The truncated version of TG2 (domain 2) also forms amyloid-like fibrils only in the presence of Ca(2+). Because amyloid formation has occurred with domain 2 alone where no enzymatic activity was shown, self-cross-linking by the enzyme was ruled out as a mechanism of amyloid induction. The self-assembly of TG2 was not significant with magnesium and zinc ions, indicating specificity of the self-assembly for calcium ions. The calcium role in self-assembly of TG2 into amyloid may be extended to other proteins with similar biophysical properties to produce novel biomaterials.

Functional Amyloids in the Mouse Sperm Acrosome

“…Known amyloidogenic proteins, of which several are implicated in amyloidosis, included lysozyme (Lyz2) (40), cystatin C (Cst3) (41), cystatin-related epididymal spermatogenic protein (CRES or Cst8) (42), albumin (Alb) (43), and keratin (Krt1 or Krt5) (44). Proteins that were related to known amyloidogenic proteins included phosphoglycerate kinase 2 (Pgk2) (45) and transglutaminase 3 (Tgm3) (46). Several proteins in the core that had predicted amyloidogenic domains have associations with neurodegenerative diseases and include low-density lipoprotein receptor-related protein 1 (Lrp1) (47,48), nebulin-related anchoring protein (Nrap) (49,50), and arginase (Arg1) (51) (see Table S1).…”

Expression of Functional Recombinant Human Tissue Transglutaminase (TG2) Using the Bac-to-Bac Baculovirus Expression System

“…23 Other investigators have also used E. coli expression system. 17,32 Expressions in the aforementioned system have led to insoluble inclusion bodies leading to the lack of activity for the enzyme. There have been some attempts to decrease the TG2 formation of inclusion bodies and increase the yield of soluble active enzyme.…”

“…There have been some attempts to decrease the TG2 formation of inclusion bodies and increase the yield of soluble active enzyme. 17,23 Because the bacterial expression systems do not carry out post-translational modifications and lack special organelles as compared to mammalian systems, this discrepancy could be the main reason for obtaining nonfunctional human recombinant proteins such as TG2 recombinant proteins. Moreover, contamination of recombinant protein with endotoxin which is often seen with the microbial expression system restrict their applications for in vivo studies.…”

“…17 The TG2 cDNA that was cloned using EcoRI, and XhoI into pET-28, was digested with the same restriction enzymes and the cleaved insert containing the entire TG2 cDNA was purified from the gel and subcloned into pUC57. After confirming correct clones, the TG2/pUC57 plasmid digested with EcoRI and HindIII and the insert subcloned into pFastBacHTA vector.…”

“…The integrity of final construct was also confirmed again by PCR using specific primers 5'CCGGAATTCATGGCCGAGGAGCTGGTCTTAGA GAGG3' (TG2-forward) and 5'AACCTCGAGTTAGGCGGGGCCAATGATGACAT TCC3' (TG2-reverse). 17 For PCR, the reaction mixture (25 μL) was composed of 15 ng extracted plasmid, 1× PCR buffer, 200 μM each dNTP, 1.5 unit of Taq DNA polymerase and 0.6 μM each primers. The PCR was performed by 35 cycles of 94 °C for 30 s, 57 °C for 40 s and extension at 72 °C for 2.5 min.…”