Self-(in)compatibility inheritance and allele-specific marker development in yellow mustard (Sinapis alba)

Abstract

Yellow mustard (Sinapis alba) has a sporophytic self-incompatibility reproduction system. Genetically stable self-incompatible (SI) and self-compatible (SC) inbred lines have recently been developed in this crop. Understanding the S haplotype of different inbred lines and the inheritance of the self-(in)compatibility (SI/SC) trait is very important for breeding purposes. In this study, we used the S-locus gene-specific primers in Brassica rapa and Brassica oleracea to clone yellow mustard S-locus genes of SI lines Y514 and Y1130 and SC lines Y1499 and Y1501. The PCR amplification results and DNA sequences of the S-locus genes revealed that Y514 carried the class I S haplotype, while Y1130, Y1499, and Y1501 had the class II S haplotype. The results of our genetic studies indicated that self-incompatibility was dominant over self-compatibility and controlled by a one-gene locus in the two crosses of Y514 × Y1499 and Y1130 × Y1501. Of the five S-locus gene polymorphic primer pairs, Sal-SLGI and Sal-SRKI each generated one dominant marker for the SI phenotype of Y514; Sal-SLGII and Sal-SRKII produced dominant marker(s) for the SC phenotype of Y1501 and Y1499; Sal-SP11II generated one dominant marker for Y1130. These markers co-segregated with the SI/SC phenotype in the F2 populations of the two crosses. In addition, co-dominant markers were developed by mixing the two polymorphic primer pairs specific for each parent in the multiplex PCR, which allowed zygosity to be determined in the F2 populations. The SI/SC allele-specific markers have proven to be very useful for the selection of the desirable SC genotypes in our yellow mustard breeding program.Electronic supplementary materialThe online version of this article (doi:10.1007/s11032-013-9943-8) contains supplementary material, which is available to authorized users.

Construction of a genetic linkage map and QTL analysis of erucic acid content and glucosinolate components in yellow mustard (Sinapis alba L.)

“…Primer pair No 1 OF (ATGACGTCCGTTAACGTA) /PR (AAGACTTGTCGTCAGCTCCA) was designed based on the FAE1 gene sequence of Y517 and generated a dominant marker of 928 bp for FAE1 gene in Y517 (F. Zeng and B.F. Cheng, personal communication, 2012), while the primer pair No 2 Sal-SRK I (GATTATCTCGTGTCTGAATG/ GGTAATGTCGAATCTCTCCT) was designed based on the class I S haplotype of Y514 and produced a dominant marker of 640 bp for the self-(in) compatibility gene in Y514 [ 25 ]. The FAE1 and self-(in)compatibility genes were mapped to their respective linkage groups based on the segregation of the two markers in the F 2 population of Y514 × Y517.…”

“…Doubled-haploid (DH) and inbred lines have lately been produced in yellow mustard at Agriculture and Agri-Food Canada-Saskatoon Research Centre (AAFC-SRC) [ 23 , 24 ]. Molecular markers for the fatty acid elongase 1 ( FAE1 ) and self-(in) compatibility genes have also been developed in our lab [ 25 ]. The objectives of the present study were 1) to construct a genetic linkage map based on ILP and SSR markers using the F 2 population derived from homozygote parental lines, 2) to identify QTLs for erucic acid content and GSL components, and 3) to assign the FAE1 and self-(in) compatibility genes to the respective linkage groups in yellow mustard.…”

Self-(In)compatibility Systems: Target Traits for Crop-Production, Plant Breeding, and Biotechnology

“…For instance, a DNA test based on the S 4 '-allele conferring SC in cherry, together with another test for fruit size, is now routinely used in a streamlined marker-assisted seedling selection scheme by a Pacific Northwest sweet cherry breeding program (Ru et al, 2015) and it is most likely used in all sweet cherry breeding programs implementing MAS. In another example, gene-specific S-locus markers have been developed at the Saskatoon Research and Development Center in Canada to select SC genotypes in yellow mustard (Sinapis alba L.) (Zeng and Cheng, 2014).…”