Seminal fluid‐mediated fitness effects in the simultaneously hermaphroditic flatwormMacrostomum lignano

Abstract

As a class, seminal fluid proteins are expected to exert strong effects on mating partners due to the selection pressures of sperm competition and sexual conflict. But because of the complexity of this secretion, linking specific proteins to downstream effects on own fitness—via manipulating the reproductive behavior, physiology, and ultimately the sperm utilization of mating partners—is not straightforward. Here, we adopted a systematic gene knockdown approach to screen for seminal fluid‐mediated fitness effects in the simultaneously hermaphroditic flatworm Macrostomum lignano. We focused on 18 transcripts in M. lignano seminal fluid, testing how their RNA interference‐induced knockdown impacted on three aspects of donor (male) reproductive success: (a) fertility (offspring production of the partner); (b) defensive sperm competitive ability, P1; and (c) offensive sperm competitive ability, P2. In general, the knockdown of most individual transcripts appeared to have only a minor impact on male reproductive success, though we found evidence that the knockdown of up to five different transcripts impacted on fertility; the knockdown of two other transcripts resulted in reduced P2; and knockdown of a further transcript actually increased P2. We thus identify a number of candidate seminal fluid transcripts that appear to modulate offspring production and sperm competitiveness in M. lignano. That only a minority of transcripts exhibit such a pattern likely reflects both the difficulty of accurately estimating sperm competitiveness and the functional redundancy of seminal fluid.

Effects of two seminal fluid proteins on post-mating behavior in the simultaneously hermaphroditic flatwormMacrostomum lignano

“…They are kept under standard conditions on a 14:10 light:dark cycle at 60% relative humidity and a constant temperature of 20°C. All the animals used in this experiment as knockdown/control donors and as recipients (see below) belonged to the highly inbred DV1 line (Janicke et al 2013) that was previously used to identify and functionally characterize putative seminal fluid candidates (Weber et al 2018; Weber et al, submitted; Patlar et al, submitted).…”

“…RNAi was performed as previously described (Kuales et al 2011), largely following the same procedures as in Weber et al (submitted) to ensure comparability of results. Briefly, for both seminal fluid candidates, a double-stranded RNA (dsRNA) probe was generated by an in vitro transcription system using primer pairs with T7 and SP6 promoter regions (T7 and SP6 Ribomax™ large scale RNA kit, Promega) (Mlig-pro46: forward primer: CTGCACGGTTGTTACCTTCG, reverse primer: TCATCTTCATAATTGCGGTGAAAG; Mlig-pro63: forward primer: ACAACTGACAATGCGATTAGC, reverse primer: CTGCTCGTACACAACCATCG).…”

“…In the control treatment we added just water instead of dsRNA; control individuals were otherwise treated identically to the knockdown individuals. Previous studies with dsRNA for firefly luciferase indicate receipt of dsRNA per se does not affect worms (Pfister et al 2008; Sekii et al 2009; Arbore et al 2015; Lengerer et al 2018; Weber et al submitted), so here we followed several other M. lignano studies in using a no dsRNA probe as the negative control (Kuales et al 2011; Lengerer et al 2014; Ramm et al 2019). The efficacy of RNAi knockdown was verified by performing whole mount in situ hybridization (ISH) in a preliminary test (Fig.…”

“…Nevertheless, there are already some indications for potential effects of SFPs. An initial screen of 18 putative SFPs selected without any prior functional information revealed that the RNAi-induced knockdown of at least some SFPs may modulate aspects of fertility and sperm competitiveness (Weber et al, submitted). However, given that this screen identified only a minority of candidate SFPs modulating fertility or sperm competitiveness, and that all of these effects have not yet been verified after controlling for multiple testing, this suggests that more targeted methods may be beneficial to first prioritise candidates mediating specific effects.…”

“…In order to test whether these proteins in seminal fluid indeed influence these behaviours and have downstream impacts on fitness, we then used RNAi to test these two putative SFPs transcripts for their effects on mating frequency in pairings with untreated partners, on the suck propensity of mating partners, as well as sperm competitive ability. Both putative SFPs were already included in the above-mentioned naïve RNAi screen (Weber et al, submitted), in which Mlig-pro46 showed some evidence for a reduced offensive sperm competitive ability ( P 2 , see below), making it an even more promising candidate for more detailed characterization.…”