Seminested PCR for Diagnosis of Candidemia: Comparison with Culture, Antigen Detection, and Biochemical Methods for Species Identification

Abstract

The rapid detection and identification of Candida species in clinical laboratories are extremely important for the management of patients with hematogenous candidiasis. The presently available culture and biochemical methods for detection and species identification of Candida are time-consuming and lack the required sensitivity and specificity. In this study, we have established a seminested PCR (snPCR) using universal and species-specific primers for detection of Candida species in serum specimens. The universal outer primers amplified the 3 end of 5.8S ribosomal DNA (rDNA) and the 5 end of 28S rDNA, including the internally transcribed spacer 2 (ITS2), generating 350-to 410-bp fragments from the four commonly encountered Candida species, viz., C. albicans, C. tropicalis, C. glabrata, and C. parapsilosis. The species-specific primers, complementary to unique sequences within the ITS2 of each test species, amplified species-specific DNA in the reamplification step of the snPCR. The sensitivity of Candida detection by snPCR in spiked serum specimens was close to 1 organism/ml. Evaluation of snPCR for specific identification of Candida species with 76 clinical Candida isolates showed 99% concordant results with the Vitek and/or ID32C yeast identification system. Further evaluation of snPCR for detection of Candida species in sera from culture-proven (n ‫؍‬ 12), suspected (n ‫؍‬ 16), and superficially colonized (n ‫؍‬ 10) patients and healthy subjects (n ‫؍‬ 12) showed that snPCR results were consistently negative with sera from healthy individuals and colonized patients. In culture-proven candidemia patients, the snPCR results were in full agreement with blood culture results with respect to both positivity and species identity. In addition, snPCR detected candidemia due to two Candida species in five patients, compared to three by blood culture. In the category of suspected candidemia with negative blood cultures for Candida, nine patients (56%) were positive by snPCR; two of them had dual infection with C. albicans and either C. tropicalis or C. glabrata. In conclusion, the snPCR developed in this study is specific and more sensitive than culture for the detection of Candida species in serum specimens. Moreover, the improved detection of cases of candidemia caused by more than one Candida species is an additional advantage.

Estudo da incidência de amostras clínicas do gênero Candida Estudo da incidência de amostras clínicas do gênero <em>Candida<em> isoladas de diversos sítios anatômicos

“…Esta confirmação fenotípica foi observada para todas as amostras testadas. Estas mesmas amostras foram também identificadas empregando-se a técnica molecular de snPCR (seminested polimerase chain reaction) como descrita por Ahmad et al (2002) (Figura 1). Esta técnica baseia-se na amplificação de uma região Acta Sci.…”

“…Contudo, o tempo de exposição e a temperatura interferem com o diagnóstico de Candida em meio cromogênicos, podendo as colônias C. albicans apresentar seqüência de colorações esverdeadas, desde colônias verdespálida até verde intenso (Odds e Davidson, 2000). Como C. dubliniensis também pode apresentar essa coloração neste meio, um dos testes fenotípicos de diferenciação é a ausência de crescimento a 42-45ºC por este fungo (Alves et al, 2000).…”

“…Health Sci. Maringá, v. 29, n. 1, p. 33-37, 2007 isoamílico (25:24:1,v/v Para a identificação molecular das amostras de Candida albicans foi utilizada a técnica de Seminested PCR (Ahmad et al, 2002), com os seguintes oligonucleotídeos iniciadores: direto universal, CTSF (5´TCGCATCGATGAAGAACGCAGC3´) e oligonucleotídeo reverso CTSR (5´TCTTTTCCTCCGCTTATTGATATGC3´). Para realização do segundo ciclo de amplificação para identificação de C. albicans, foram utilizados oligonucleotídeos espécie-específicos denominado CADET (5´ATTGCTTGCGGCGGTAACGTCC 3´).…”

Enteropatógenos relacionados à diarréia em pacientes HIV que fazem uso de terapia anti-retroviral

“…A cultura pura do isolado foi obtida a partir de uma única colônia. A identificação das espécies de leveduras foi realizada através da reação em cadeia da polimerase (PCR) descrita por Ahmad e cols 1 . Para o isolamento de bactérias, as fezes foram diluídas em salina estéril e caldo selenito para posterior semeadura em agar Mac Conkey e agar SS, respectivamente.…”

Evaluation of semi-nested polymerase chain reaction (PCR) and mannan antigen detection compared to blood culture for diagnosis of candidemia

“…Different molecular methods for detection of candidia infection, have been used such as real time PCR (Liguori et al, 2007;Li et al, 2003), Multiplex PCR (Sampath et al, 2017) and nested PCR (Ahmad et al, 2002;Çerikçioglu et al, 2010).…”