Sequence of cDNA encoding human insulin-like growth factor I precursor

Abstract

Somatomedins (SM) or insulin-like growth factors (IGF) constitute a heterogeneous group of peptides with important growth-promoting effects in vitro as well as in vivo. Amino acid sequences have been determined for only two of them, IGF-I and IGF-II, which are highly homologous. IGF-I, which is identical with SM-C, is composed of 70 amino acid residues and IGF-II contains 73 amino acids and may be identical with SM-A. Other peptides with different charge properties but with similar SM-like or insulin-like behaviour in biological and receptor assays, have been described but have not yet been fully characterized. The liver is known to be a major site of production of these peptides, but many other tissues--especially in the fetus--may synthesize them as well. We report here the nucleotide sequence of a human liver cDNA encoding the complete amino acid sequence of IGF-I. The IGF-I coding region is flanked by sequences encoding an amino-terminal peptide of at least 25 amino acid residues and a carboxyl-terminal peptide of 35 amino acids. This provides evidence that IGF-I is synthesized as a precursor protein and that formation of IGF-I from this precursor requires proteolytic processing at both ends.

Overexpression of insulin-like growth factor-1 induces hyperplasia, dermal abnormalities, and spontaneous tumor formation in transgenic mice

“…The human IGF-1 cDNA was excised from the parent vector pGEM (a gift from Dr KH Gabbay, Baylor College of Medicine) (Jansen et al, 1983), with restriction enzymes EcoRI and BamHI. The termini of this fragment, containing the B-, C-, and A-chains of IGF-1, were ®lled in with the Klenow form of DNA polymerase and the blunt-ended fragment was ligated into the SmaI restriction enzyme site of the keratinocyte expression vector pHK1 (a gift from Dr Dennis Roop, Baylor College of Medicine) (Rothnagel et al, 1990).…”

Histamine-stimulated expression of insulin-like growth factors in human glioma cells

“…Specific mRNAs were detected by in situ hybridization (Wilkinson and Green, 1992), with probes for human IGF-I and human IGF-II. The probes were prepared by linearizing cDNA of IGF-I (pIGF-I, exons 1, 3 and 4; 777 base pairs; Jansen et al, 1983) and of IGF-II (pIGF-IIvar, exons 3, 7, 8 and 9; 713 base pairs ; (1992); both antisera were used in a dilution of 1:200]. Control slides were incubated without the primary antibody.…”

Skeletal muscle regeneration after insulin-like growth factor I gene transfer by recombinant Sendai virus vector

“…This peptide is expected to be the hIGF-I precursor, which has an additional peptide of 35 amino acid residues at its carboxyl terminus. 17 This protein species was absent in the LacZ/SeV-infected samples ( Figure 1a, lane 2). These results demonstrated that substantial amounts of hIGF-I were produced by the recombinant SeV vector and were secreted into the culture supernatant.…”

“…17 The resulting PCR product was cloned at the EcoRI site of pBluescript II and then was sequenced. To generate phIGF-I/SeV, the product with the correct sequence of hIGF-I gene was reamplified with primers containing SeV-specific transcriptional regulation signal sequences, 5Ј-ATCCGCGG CCGCCAAAGTTCAGCAATGGGAAAAATCAGCAGT CTTC-3Ј and 5Ј-ATCCGCGGCCGCGATGAACTTTCA CCCTAAGTTTTTCTTACTACGGCTACATCCTGTAGT TCTTGTTTCCTGC-3Ј and was cloned in the NotI site of pSeV18+b(+) which had been constructed to produce the exact SeV full-length antigenomic plus sense RNA of 15 402 nucleotides.…”

“…This molecular mass was not consistent with that observed in the culture supernatant (12-13 kDa, Figure 1a), thus indicating that the hIGF-I was truncated in vivo, thus transforming into the mature form of 70 amino acid residues. 17 No band reactive to the anti hIGF-I antibody was observed in the concentrated serum of the animals infected by LacZ/SeV (Figure 4a, lanes 2 and 3).…”