Sequence of the genes encoding the structural proteins of the low-virulence tick-borne flaviviruses Langat TP21 and Yelantsev

Mandl, Christian W.; Iacono-Connors, Lauren C.; Wallner, Gerhard; Holzmann, Heidemarie; Künz, Christian; Heinz, Franz X.

doi:10.1016/0042-6822(91)90567-u

Cited by 48 publications

(27 citation statements)

References 20 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Alignment of the amino acid sequences of the E proteins of flaviviruses within the type-specific hypervariable domain proposed for TBE and dengue viruses. Sequences of LI (Shiu et al, 1991), TBE (Mandl et al, 1988;Ptetnev et al, 1990), LGT (Mandl et al, 1991), DEN1 (Mason et al, 1987), DEN2 (Deubel et al, 1986;Hahn et al, 1988), DEN3 (Osatomi & Sumiyoshi, 1990), DEN4 (Zhao et al, 1986), West Nile (WN) (Castle et al, 1985), Kunjin (KUN) (Coia et al, 1988), Japanese encephalitis (JE) (Sumiyoshi et al, 1987), Murray Valley encephalitis (MVE) (Dalgarno et al, 1986), St Louis encephalitis (SLE) (Trent et al, 1987) and yellow fever (Rice et al, 1985) viruses are aligned. The amino acids are numbered according to their positions in the respective E proteins.…”

Section: S S T ---A 232 Mve 228 P As T ---E 232 Sle 228 P At T ---D 2mentioning

confidence: 99%

“…2), TBE and LI viruses (K. Venugopal, personal communication). In addition, this hypervariable domain of dengue viruses is located within an antigenic region (amino acids 225 to 249) in the E protein of DEN2 which has been defined by the use of synthetic peptides (Roehrig et al, 1990), whereas those of TBE, LI and LGT viruses are likely to constitute part of a neutralization-sensitive region of the E protein (Mandl et al, 1989(Mandl et al, , 1991Shiu et al, 1991). Based on these observations, we would like to propose that this type-specific hypervariable domain may be useful as a genetic marker for typing dengue and tick-borne flaviviruses.…”

Section: S S T ---A 232 Mve 228 P As T ---E 232 Sle 228 P At T ---D 2mentioning

confidence: 99%

See 1 more Smart Citation

Envelope protein sequences of dengue virus isolates TH-36 and TH-Sman, and identification of a type-specific genetic marker for dengue and tick-borne flaviviruses

Shiu

Jiang

Porterfield³

et al. 1992

Journal of General Virology

View full text Add to dashboard Cite

Complementary DNAs were synthesized from the envelope protein genes of two isolates of dengue virus (TH-36 and TH-Sman, previously suggested as possible dengue virus type 5 and dengue virus type 6 respectively) and amplified by the polymerase chain reaction using sense and antisense primers designed from conserved dengue virus gene sequences. The amplified cDNA clones were sequenced in both directions by double-stranded dideoxynucleotide sequencing. Alignment with published dengue virus sequences enabled us to assign these viruses accurately to classified serotypes, confirming that TH-36 and THSman are strains of dengue virus type 2 and dengue virus type 1 respectively. Amino acid changes between the proteins encoded by these two isolates and strains of their respective serotypes may account for the significant antigenic differences observed during previous serological typing of these viruses. Moreover, sequence alignment of flavivirus envelope proteins revealed a hypervariable region, within which members of the dengue and tick-borne virus antigenic complexes show unique peptide sequences. This type-specific hypervariable domain may be useful as a genetic marker for typing dengue and tick-borne flaviviruses.Dengue viruses, mosquito-borne members of the family Flaviviridae (Westaway et al., 1985), are responsible for classic dengue fever and for the associated conditions dengue haemorrhagic fever (DHF) and dengue shock syndrome, each of which has a high level of morbidity and mortality in the tropics. There is evidence suggesting that the more severe forms of dengue fever occur when individuals (usually children) with cross-reactive but non-protective antibodies, acquired maternally or induced by prior infection with a different serotype, are naturally exposed to dengue virus infection (Halstead, 1981(Halstead, , 1988. Despite much research, effective dengue virus vaccines are not yet available, so the antigenic properties of dengue viruses have received much attention.Currently, four distinct dengue virus serotypes (types 1 to 4; DEN1 to DEN4) can be distinguished by complement fixation (CF), haemagglutination-inhibition and neutralization tests (Porterfield, 1980). Two Thai isolates are of particular interest. Strain TH-36 wasThe sequence data reported in this article have been deposited with the DDBJ, EMBL and GenBank databases under the accession numbers D01073 (TH-Sman) and D01074 (TH-36). isolated in 1958 by Hammon and co-workers from a patient with DHF in Bangkok, and TH-Sman was isolated from a similar patient by Dr Sman Vardhanabhuti. Strain TH-36 was initially identified as DEN2 and TH-Sman as DEN 1, but both were shown to differ to a significant degree from the respective prototype strains by CF, plaque neutralization, immunodiffusion and immunoelectrophoresis tests (Hammon et al., 1961; Hammon & Sather, 1964a, b; Ibrahim & Hammon, 1968a, b;Ibrahim et al., 1968). Tests using the soluble complement-fixing antigen also showed that strain THSman differed from the prototype DEN1 virus, but TH-36 was ind...

show abstract

Section: S S T ---A 232 Mve 228 P As T ---E 232 Sle 228 P At T ---D 2mentioning

confidence: 99%

Section: S S T ---A 232 Mve 228 P As T ---E 232 Sle 228 P At T ---D 2mentioning

confidence: 99%

Envelope protein sequences of dengue virus isolates TH-36 and TH-Sman, and identification of a type-specific genetic marker for dengue and tick-borne flaviviruses

Shiu

Jiang

Porterfield³

et al. 1992

Journal of General Virology

View full text Add to dashboard Cite

show abstract

“…PCR then was used to amplify overlapping cDNA fragments of the LGT TP21 or E5 genome. The sequences of the PCR primers were derived from the published coding region of LGT TP21 strain (7,16). The PCR fragment corresponding to the 5Ј-noncoding region was generated by using a primer that contained the first 21 conserved 5Ј-terminal nucleotides of the TBEV genome (13,14,17).…”

mentioning

confidence: 99%

Attenuation of the Langat tick-borne flavivirus by chimerization with mosquito-borne flavivirus dengue type 4

Pletnev

Men

1998

Proc. Natl. Acad. Sci. U.S.A.

104

122

View full text Add to dashboard Cite

Langat virus (LGT) strain TP21 is the most attenuated of the tick-borne flaviviruses for humans. Even though LGT has low-level neurovirulence for humans, it, and its more attenuated egg-passage derivative, strain E5, exhibit significant neurovirulence and neuroinvasiveness in normal mice, albeit less than that associated with tick-borne encephalitis virus (TBEV), the most virulent of the tick-borne flaviviruses. We sought to reduce or ablate these viral phenotypes of TP21 and E5 by using a strategy that had been used successfully in the past to reduce neurovirulence and abolish neuroinvasiveness of TBEV, namely substitution of structural protein genes of the tick-borne flavivirus for the corresponding genes of dengue type 4 virus (DEN4). In pursuit of these objectives different combinations of LGT genes were substituted into the DEN4 genome but only chimeras containing LGT structural proteins premembrane (preM) and envelope glycoprotein (E) were viable. The infectious LGT(preM-E)͞DEN4 chimeras were restricted in replication in simian cell cultures but grew to moderately high titer in mosquito cell culture. Also, the chimeras were at least 5,000 times less neurovirulent than their parental LGT virus in suckling mice. Significantly, the chimeras lacked detectable evidence of neuroinvasiveness after i.p. inoculation of Swiss mice or the more permissive SCID mice with 10 5 or 10 7 plaque-forming units (PFU), respectively. Nonetheless, i.p. inoculation of Swiss mice with 10 or 10 3 PFU of either chimeric virus induced LGT neutralizing antibodies and resistance to fatal encephalitis caused by i.p. challenge with LGT TP21. The implications of these observations for development of a live attenuated TBEV vaccine are discussed.Tick-borne flaviviruses are endemic throughout most of the Northern Hemisphere, causing disease of varying severity that can have a mortality as high as 20-30% (1). Similar to all flaviviruses, viruses of the tick-borne group have a positive sense nonsegmented RNA genome that encodes a single long polyprotein that is processed to yield capsid (C), premembrane (preM), envelope glycoprotein (E) structural proteins followed by nonstructural protein NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5 in that order (2, 3). These tick-borne viruses share envelope glycoprotein epitopes that often induce cross-resistance among viruses of the group. These properties of antigenic crossreactivity and virulence polymorphism suggested that successful immunization might be achieved by using a live, naturally attenuated tick-borne flavivirus. The impetus for this approach was the recovery of a virus from ticks in Malaysia, namely Langat virus (LGT), that did not appear to be associated with human disease under natural conditions (4, 5).Approximately 30 years ago Yelantsev virus (6), which subsequently was shown to be identical to wild-type LGT, strain TP21 (7), was evaluated in 649,479 individuals as a candidate live attenuated vaccine for prevention of tick-borne encephalitis. Studies were discontinued when it was ...

show abstract

“…Several flaviviruses have been sequenced and they have a similar molecular organization (Dalgarno et al, 1986;Deubel et al, 1986Deubel et al, , 1988McAda et al, 1987;Mandl et al, 1988Mandl et al, , 1989Mandl et al, , 1991Pletnev et al, 1990;Rice et al, 1985;Shiu et al, 1991 ;Sumiyoshi et al, 1987;Trent et al, 1987). The viral proteins are encoded in one open reading frame and the entire gene order of both the structural and nonstructural (NS) proteins is known to be core, premembrane (prM), membrane, envelope (E), NS1, NS2a, NS2b, NS3, NS4a, NS4b and NS5 (Bell et al, 1985 ; S R C T H L E N R D F V T G T Q G T T R UCACGAUGCACGCAUCUGGAAAACAGGGACUUUGUGACUGGCACCCAGGGAACCACACG C i0 20 30 40 50 CCCGUCAGGGCUGUGGCACAUGGAUCCCCAGAUGUGGAUGUGGCCAUGCUCAUAACGCCA 1030 1040 1050 1060 1070 1080 AAUCCAACAAUCGAAAACAAUGGAGGUGGCUUUAUAGAGAUGCAGCUCCCCCCAGGAGAC 1090 1100 1110 1120 1130 1140…”

mentioning

confidence: 99%

Nucleotide and deduced amino acid sequence of the envelope glycoprotein of Omsk haemorrhagic fever virus; comparison with other flaviviruses

Грицун¹,

Lashkevich

Gould³

1993

Journal of General Virology

View full text Add to dashboard Cite

The gene encoding the envelope glycoprotein of Omsk haemorrhagic fever (OHF) virus was cloned and sequenced. A freeze-dried preparation of infected suckling mouse brain suspension was used as the source material for viral RNA. The derived cDNA was amplified using the polymerase chain reaction and the cloned DNA sequenced by dideoxynucleotide sequencing. Alignment of the OHF virus sequence with those of other known tick-borne flaviviruses showed that they shared Nglycosylation sites, cysteine residues, the fusion peptide and a hexapeptide (EHLPTA) that identifies tick-borne flaviviruses. OHF virus was distinguishable from the other viruses but shared closest amino acid identity (93-0%) with the tick-borne encephalitis viruses. A sequence of three amino acids (AQN; amino acids 232 to 234), which was previously shown to be specific for the tick-borne encephalitis viruses, was altered to MVG in OHF virus. This is predicted to have a higher hydrophobicity than the AQN sequence and may therfore have significant implications for the phenotypic characteristics of OHF virus. The results demonstrate close phylogenetic relationships between these viruses but also show their distinct evolutionary development. Sequence changes within the envelope glycoprotein of OHF virus have been identified that may be responsible for the distinct tropism of this flavivirus. These results support and enlarge upon previous data obtained from serological analysis.

show abstract

Sequence of the genes encoding the structural proteins of the low-virulence tick-borne flaviviruses Langat TP21 and Yelantsev

Cited by 48 publications

References 20 publications

Envelope protein sequences of dengue virus isolates TH-36 and TH-Sman, and identification of a type-specific genetic marker for dengue and tick-borne flaviviruses

Envelope protein sequences of dengue virus isolates TH-36 and TH-Sman, and identification of a type-specific genetic marker for dengue and tick-borne flaviviruses

Attenuation of the Langat tick-borne flavivirus by chimerization with mosquito-borne flavivirus dengue type 4

Nucleotide and deduced amino acid sequence of the envelope glycoprotein of Omsk haemorrhagic fever virus; comparison with other flaviviruses

Contact Info

Product

Resources

About