Sequencing of
            <i>hsp65</i>
            Distinguishes among Subsets of the
            <i>Mycobacterium avium</i>
            Complex

Turenne, Christine Y.; Semret, Makeda; Cousins, Debby; Collins, Desmond M.; Behr, Marcel A.

doi:10.1128/jcm.44.2.433-440.2006

Cited by 139 publications

(165 citation statements)

References 41 publications

Supporting

Mentioning

162

Contrasting

Order By: Relevance

“…A study by Turenne et al (52), who used a PCR-and sequencing-based strategy to investigate the complete hsp65 gene in the MAC, identified 10 SNPs that differentiated M. avium subsp. hominissuis and M. avium subsp.…”

Section: Discussionmentioning

confidence: 99%

“…The corresponding gene products could be used to identify immune responses against this M. avium subspecies, and misinterpretations due to cross-reactivity in current diagnostics for Johne's disease would thereby be avoided. This subspecies is a heterogeneous group of strains with at least six distinct hsp65 sequences (hsp65 sequevars) (52). This has previously led to the suggestion that human isolates simply reflect what is found in their environment (44).…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Genomic Comparison of PE and PPE Genes in the Mycobacterium avium Complex

et al. 2009

Self Cite

View full text Add to dashboard Cite

The Mycobacterium avium complex (MAC) comprises genomically similar but phenotypically divergent bacteria that inhabit diverse environments and that cause disease in different hosts. In this study, a wholegenome approach was used to examine the polymorphic PE (Pro-Glu) and PPE (Pro-Pro-Glu) gene families, implicated in immunostimulation and virulence. The four major groups of MAC organisms were examined, including the newly sequenced type strains of M. intracellulare and M. avium subsp. avium, plus M. avium subsp. paratuberculosis and M. avium subsp. hominissuis, for the purpose of finding genetic differences that could be exploited to design diagnostic tests specific to these groups and that could help explain their divergence in pathogenesis and host specificity. Unique and missing PPE genes were found in all MAC members except M. avium subsp. avium. Only M. intracellulare had a unique PE gene. Apart from this, most PE and PPE sequences were conserved, with average nucleotide sequence identities of 99.1 and 98.1%, respectively, among the M. avium subspecies, but only 82.9 and 79.7% identities with the PE and PPE sequences of M. intracellulare, respectively. A detailed analysis of the amino acid sequences was performed between M. avium subsp. paratuberculosis and M. avium subsp. hominissuis. Most differences were detected in the PPE proteins, with amino acid substitutions and frame shifts leading to unique amino acid sequences. In conclusion, several unique PPE proteins were identified in MAC organisms next to numerous polymorphisms in both the PE and PPE gene families. These substantial differences could help explain the divergence in phenotypes within the MAC and could lead to diagnostic tests with better discriminatory abilities.Mycobacterium avium and Mycobacterium intracellulare are collectively known as the Mycobacterium avium complex (MAC). For genotypic, phenotypic, and historical reasons, multiple subspecies of M. avium are recognized; these include Mycobacterium avium subsp. paratuberculosis, M. avium subsp. hominissuis, Mycobacterium avium subsp. avium, and M. avium subsp. silvaticum (50). All four M. avium subspecies and M. intracellulare possess a high degree of genetic similarity but are capable of infecting a diverse range of host species.M. avium subsp. paratuberculosis is the causative organism of Johne's disease (paratuberculosis), a debilitating chronic enteritis in ruminants (49), and has been implicated in Crohn's disease in humans (18). M. avium subsp. avium and M. avium subsp. silvaticum are limited almost exclusively to avian species (53), in which they cause tuberculosis. M. avium subsp. hominissuis is a recent designation and was added to reflect the distinction of human and porcine isolates from bird-type strains when genotypic methods showed that M. avium isolates from humans in particular but also pigs rarely shared the genetic profiles of organisms found in birds (38,53). M. avium subsp. hominissuis and M. intracellulare are ubiquitous, saprophytic mycobacteria commonly found in so...

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Genomic Comparison of PE and PPE Genes in the Mycobacterium avium Complex

et al. 2009

Self Cite

View full text Add to dashboard Cite

show abstract

“…For ITS amplification and sequencing, we used primers Ec16S.1390p and Mb23S.44n (Frothingham & Wilson, 1993) and 38 cycles of an initial 5 min denaturation at 95 uC, followed by 30 s denaturation at 94 uC, 30 s annealing at 62 uC and 90 s extension at 72 uC, with final extension for 7 min. For amplification and sequencing of the 39 end of hsp65, we initially used the primer pair hsp65-574F and hsp65-R (Turenne et al, 2006); since these primers failed to amplify the homologous sequence in M. colombiense, we further designated primers hsp65-F106 (59 AACGTCGTCCTGGAGAAGAA 39) and hsp65-R1558 (59 GC CTTCTCCGGCTTGTC 39), which covered almost the entire hsp65 gene in this species with hsp65-574F (59 GGTTCGACAAGGGYTACATC 39) as an additional primer for sequencing the 39 region of the gene. The conditions of PCR were 5 min at 95 uC, followed by 35 cycles of 95 uC for 45 s, 60 uC for 45 s and 72 uC for 90 s, with a final extension for 7 min.…”

Section: Methodsmentioning

confidence: 99%

“…paratuberculosis strains and disclosed six M. avium subsp. hominissuis sequavars (Turenne et al, 2006). Intergenic spacer (ITS) sequencing (Abed et al, 1995;Barry et al, 1991;Glennon et al, 1994;Roth et al, 1998) further subdivided MAC into 32 sequevars and recently delineated M. chimaera (Tortoli et al, 2004) and M. colombiense (Murcia et al, 2006).…”

Section: Introductionmentioning

confidence: 99%

rpoB sequence-based identification of Mycobacterium avium complex species

et al. 2008

View full text Add to dashboard Cite

The Mycobacterium avium complex (MAC) comprises slowly growing mycobacteria responsible for opportunistic infections and zoonoses. The ability to speciate MAC isolates in the clinical microbiology laboratory is critical for determining the organism implicated in clinical disease and for epidemiological investigation of the source of infection. Investigation of a 711 bp variable fragment of rpoB flanked by the Myco-F/Myco-R primers found a 0.7-5.1 % divergence among MAC reference strains, with Mycobacterium chimaera and Mycobacterium intracellulare being the most closely related. Using a 0.7 % divergence cut-off, 83 % of 100 clinical isolates, which had been previously identified by phenotypic characteristics and 16S-23S rDNA intergenic spacer (ITS) probing, were identified as M. avium, 8 % as M. intracellulare and 2 % as M. chimaera. The uniqueness of seven isolates, exhibiting ,99.3 % rpoB sequence similarity with MAC reference strains, was confirmed by 16S rDNA, ITS and hsp65 sequencing and phylogenetic analyses. Partial rpoB gene sequencing using the Myco-F/Myco-R primers permits one-step identification of MAC isolates at the species level and the detection of potentially novel MAC species.

show abstract

“…PCR amplification and sequencing were performed for the 16S rRNA gene (Weisburg et al, 1991), the ITS-1 spacer (Frothingham & Wilson, 1993) and for parts of the hsp65 (Turenne et al, 2006) and rpoB genes (Ben Salah et al, 2008). Products of the sequencing reactions were analysed with an ABI Prism 3100 DNA sequencer following the standard protocol of the supplier (Perkin Elmer Applied Biosystems).…”

Section: Genotypic Characterizationmentioning

confidence: 99%