Serotonin transporter binding and acquired obesity — An imaging study of monozygotic twin pairs

Cerebral serotonin transporter binding is inversely related to body mass index

“…In contrast, twins with higher BMI were found to have higher SERT binding, as measured with [ 123 I]nor-β-CIT SPECT, than their monozygotic twin sibling with lower BMI (Koskela et al, 2008). In the latter study, however, BMI did not correlate with SERT binding in the entire group of 31 subjects and [ 123 I]nor-β-CIT is not considered an optimal radiotracer for measurements of SERT.…”

“…At re-examination after 8-24 months of SSRI treatment SERT binding in the binge eating obese subjects was increased (Tammela et al, 2003). In a recent [ 123 I]nor-β-CIT SPECT study including 16 monozygotic twin pairs, twins with a BMI higher than their monozygotic co-twins were found to have higher SERT binding (Koskela et al, 2008). In two independent large samples of healthy human subjects we previously detected a positive association between BMI and global neocortical 5-HT 2A receptor binding (Adams et al, 2004;Erritzoe et al, 2009) supporting the notion that overweight subjects might have lower cerebral 5-HT levels (Roth et al, 1998;Cahir et al, 2007).…”

No correlation between body mass index and striatal dopamine transporter availability in healthy volunteers using SPECT and [123I]PE2I

“…Thus, at the time of measurement, the DAT availability will reflect sum of both genetic factors and environmental factors common or unique to the individual studied; factors that may counterbalance each other. Koskela et al elegantly addressed this question and found no difference in DAT availability in monozygotic twin pairs (n ¼ 15) with different BMI 24.5 6 3.1 kg/m 2 versus 26.8 6 3.6 kg/m 2 (15). However, the difference in BMI between twin siblings probably was too small to definitely exclude the involvement of DAT in obesity beyond what is inherited.…”

Evaluation of the 5-<i>HTTLPR</i> and 5-<i>HTTVNTR</i> Polymorphisms in the Serotonin Transporter Gene in Women with Postpartum Depression

“…DNA fragments with the 5-HTTVNTR polymorphism were amplified by polymerase chain reaction (PCR) using the forward primer 5' GTCAGTATCACAGGCTGCGAG 3' and the reverse primer 5' TGTTCCTAGTCTTACGCCAGTG 3' and employing conditions that were previously described [27]. The amplification of the 5-HTTLPR polymorphism was performed using the forward primer 5' GCGCTCCTGCATCCCCCATTA 3' and the reverse primer 5' GGGATGCGGGGGAATACTGGT 3'; this PCR reaction produced a 297 bp (L allele) and a 253 bp (S allele) fragment [12]. The genotypes of 5-HTTLPR and 5-HTTVNTR were determined by separating the amplified products by electrophoresis on a 2.5% agarose gel containing ethidium bromide and using a 50-bp ladder to determine band sizes.…”

“…SERT is encoded by the SLC6A4 gene located within the 17q11.1-q12 region [12] of chromosome 17. The expression of this gene is influenced by its genetic variants.…”