Simple, sensitive and species-specific assays for detecting quagga and zebra mussels (Dreissena rostriformis bugensis and D. polymorpha) using environmental DNA

Abstract

Ireland, being an island situated on Europe's western seaboard, has a fewer number of native species than mainland European Union Member States (MS). Increased numbers of vectors and pathways have reduced the island's biotic isolation, increasing the risk of new introductions and their associated impacts on native biodiversity. It is likely that these risks are greater here than they are in continental MSs, where the native biodiversity is richer. A horizon scanning approach was used to identify the most likely invasive alien species (IAS) (with the potential to impact biodiversity) to arrive on the island of Ireland within the next ten years. To achieve this, we used a consensus-based approach, whereby expert opinion and discussion groups were utilised to establish and rank a list of 40 species of the most likely terrestrial, freshwater and marine IAS to arrive on the island of Ireland within the decade 2017-2027. The list of 40 included 18 freshwater, 15 terrestrial and seven marine IAS. Crustacean species (freshwater and marine) were taxonomically dominant (11 out of 40); this reflects their multiple pathways of introduction, their ability to act as ecosystem engineers and their resulting high impacts on biodiversity. Freshwater species dominated the top ten IAS (seven species out of ten), with the signal crayfish (Pacifastacus leniusculus) highlighted as the most likely species to arrive and establish in freshwaters, while roe deer (Capreolus capreolus) (second) and the warm-water barnacle (Hesperibalanus fallax) (fifth), were the most likely terrestrial and marine invaders. This evidence-based list provides important information to the relevant statutory agencies in both the Republic of Ireland and Northern Ireland to prioritise the prevention of the most likely invaders and aid in compliance with legislation, in particular the EU Regulation on Invasive Alien Species (EU 1143/2014). Targeted biosecurity in both jurisdictions is urgently required in order to manage the pathways and vectors of arrival, and is vital to maintaining native biodiversity on the island of Ireland.

Targeted and passive environmental DNA approaches outperform established methods for detection of quagga mussels, Dreissena rostriformis bugensis in flowing water

“…Mesocosm validation provides an opportunity to test the LoD of eDNA assays and to investigate the relationship between density, time, and DNA copy number (Dejean et al., 2011; Blackman et al., 2020; Thomsen et al., 2012). DNA was detected with qPCR at all three densities (1, 5, and 20 individuals) within 4 hr of being present, in agreement with previous cPCR results (Blackman et al., 2020). The LoD from serial dilutions of tissue DNA was also identical for cPCR and qPCR (1 × 10 –4 ng/µl).…”

“…On day 21, the specimens were removed, and sampling continued at: 22, 28, 35, and 42 days ( n = 130). Two hundred milliliter water samples were collected at each time point, and each sample was filtered through a single filter membrane following the same protocol as the field samples (Blackman et al., 2020).…”

“…We used a cPCR assay to detect the quagga mussel, D. r. bugensis , using a species‐specific primer pair targeting a 188 bp fragment of the cytochrome oxidase I (COI) gene (DRB1_F – 5ʹ‐GGAAACTGGTTGGTCCCGAT3ʹ‐ and DRB1_R 5ʹ‐GGCCCTGAATGCCCCATAAT‐3ʹ, see Supplementary Material for full cPCR protocol). The DRB1 cPCR assay has shown to be highly sensitive (positive detection with 0.001 ng of target tissue DNA per reaction) and does not cross amplify closely related Dreissenid or native mussel species (Blackman et al., 2020). All mesocosm ( n = 130), field samples ( n = 66), and control samples (field (3), filter (3) and cPCR (6) blanks) were tested with the DRB1 assay.…”

“…Quantitative PCR has the added advantage of providing the number of DNA copies in a sample, which has been successfully linked to biomass or abundance of some taxa (e.g., Amphibians, Thomsen et al., 2012; Fish, Takahara et al., 2012; Gastropods, Goldberg et al., 2013). However, qPCR requires the construction of calibration curves from known standard concentrations and is substantially more expensive and time‐consuming than cPCR (Nathan et al., 2014) and maybe less accessible to end‐users than cPCR (Blackman et al., 2020).…”

“…Due to its wider tolerance to environmental conditions, it has the potential to spread rapidly and occupies a greater range of habitat than the closely related zebra mussel, Dreissena polymorpha, which has already spread throughout much of Europe and North America (Nalepa et al., 2010; Gallardo & Aldridge, 2013; Quinn et al., 2014). Motivated by a need for cost‐effective tools for quagga mussel detection, we previously designed a cPCR assay, which provided 100% detection rate in field trials with quagga mussel populations (Blackman et al., 2020). Here, we further developed and validated this assay for abundance estimation using a dye‐based qPCR approach in mesocosm experiments and field trials.…”