Simultaneous Identification of 14 Genital Microorganisms in Urine by Use of a Multiplex PCR-Based Reverse Line Blot Assay

Abstract

The aim of this study was to develop and evaluate a sensitive method for the simultaneous identification of 14 urogenital potential pathogens. A multiplex PCR-based reverse line blot (mPCR/RLB) assay was developed to detect 14 urogenital pathogens or putative pathogens, namely Trichomonas vaginalis, Streptococcus pneumoniae, Neisseria gonorrhoeae, Chlamydia trachomatis, Ureaplasma parvum, U. urealyticum, Gardnerella vaginalis, Haemophilus influenzae, herpes simplex virus type 1 (HSV1) and HSV2, N. meningitidis, Mycoplasma hominis, M. genitalium, and adenovirus, using two species-specific primer pairs and probes for each. The method was validated using a reference strain or a well-characterized clinical isolate of each target organism and was found to be both sensitive and specific. The limits of detection for the mPCR/RLB assay varied among the 14 target organisms from 4.2 ؋ 10 ؊1 to 7.0 ؋ 10 ؊11 ng/l of genomic DNA. There were no cross-reactions among any of the probes. This method was used to test 529 first-voided urine specimens from male patients with and without urethritis attending two Sydney sexual health clinics. One or more target species were detected in 193 (36%) subjects. Of 233 positive results, overall 216 (93%) were concordant between mPCR/RLB and a comparator method (culture and/or species-specific PCR), 9 were positive only by mPCR/RLB, and 8 were positive only by the comparator method. The mPCR/RLB method was an accurate, convenient, and inexpensive method for the detection of multiple potential pathogens in first-voided urine specimens from men.Sexually transmitted infections (STIs) are a major global health problem. Worldwide, an estimated 340 million cases of curable STIs, including chlamydial infection, gonorrhea, trichomoniasis, and syphilis, occur annually, and their incidence is increasing in many parts of the world. In developing countries, their complications rank in the top five disease categories for which adults seek health care (www.who.int /mediacentre/factsheets/fs110/en/). Many STIs cause asymptomatic infection; for example, up to 70% of men and women with gonococcal and/or chlamydial infections are symptom free (www.who.int/mediacentre/factsheets/fs110/en/), which creates the potential for unrecognized transmission with significant implications for both individual and population health.Urethritis is characterized by discharge and dysuria (37) and is broadly classified as nongonococcal (NGU) or gonococcal. It occurs in both men and women but often is unrecognized in women. Acute NGU is one of the commonest STIs affecting heterosexual men, yet a specific pathogen, most commonly Chlamydia trachomatis, is identified in only 50 to 70% of cases (7). Pelvic inflammatory disease is an important complication of STI in women; C. trachomatis and N. gonorrhoeae commonly are implicated, but often the cause is unknown. Bacterial vaginosis is the commonest cause of vaginal discharge and is associated both with recognized STIs and other genital syndromes (3,18). Additional epidemiological stud...

Infecciones de transmisión sexual silentes: la muestra de orina permite una adecuada detección

“…Esta muestra puede ser utilizada tanto para cultivo como para detección a través de técnicas de biología molecular, permitiendo disminuir los falsos negativos de la serología y aumentar la pesquisa de pacientes que presenten este tipo de infecciones 56 . Como se mencionó anteriormente, la amplificación de ácidos nucleicos es la técnica sensible con mayor especificidad para la detección de la infección por C. trachomatis, la que se realiza principalmente utilizando muestras tales como, citobrush, secreción vaginal y/o secreción uretral 29 .…”

“…Por ello, este tipo de muestra, sería de gran utilidad para detectar C. trachomatis en ambos géneros 56 . En el caso de la detección en mujeres, en necesario complementar la muestra de orina junto con citrobrush, ya que la infección por C. trachomatis puede afectar tanto el tracto genital como el tracto uretral por separado 57 .…”

Frecuencia de la infección por Chlamydia trachomatis en un grupo de mujeres de la Región de la Araucanía, Chile

“…Se utilizó un juego de partidores (partidor forward GG-GATTCCTGTAACAACAAGTCAGG y partidor reverse CCTCTTCCCCAGAACAATAAGAACAC) diseñados por McKechnie y cols., 2009 9 . Estos partidores están dirigidos al plásmido críptico de C. trachomatis y generan un producto de 208 pares de bases.…”

Multiplex PCR and Reverse Line Blot Hybridization Assay (mPCR/RLB)

“…, typing of methicillin-resistant Staphylococcus aureus [3][4][5] and Salmonella sp 6 , molecular serotyping of Streptococcus pneumoniae 7,8 , Streptococcus agalactiae 9 and enteroviruses 10,11 , identification of Mycobacterium sp 12 , detection of genital [13][14][15] and respiratory tract 16 and other 17 pathogens and detection and identification of mollicutes 18 . However, the versatility of the technique means the applications are virtually limitless and not restricted to molecular analysis of micro-organisms.…”